ID: 925721453

View in Genome Browser
Species Human (GRCh38)
Location 2:6832206-6832228
Sequence CATCTTTAGCAGCTTTATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925721453_925721455 13 Left 925721453 2:6832206-6832228 CCTCGATAAAGCTGCTAAAGATG No data
Right 925721455 2:6832242-6832264 TCCATGCTGTTGTAGAAAATAGG No data
925721453_925721457 14 Left 925721453 2:6832206-6832228 CCTCGATAAAGCTGCTAAAGATG No data
Right 925721457 2:6832243-6832265 CCATGCTGTTGTAGAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925721453 Original CRISPR CATCTTTAGCAGCTTTATCG AGG (reversed) Intergenic
No off target data available for this crispr