ID: 925722070

View in Genome Browser
Species Human (GRCh38)
Location 2:6839154-6839176
Sequence GTTCCAGCTAAGTTTAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925722065_925722070 19 Left 925722065 2:6839112-6839134 CCTGTTCCCTGAAGGGATGGTTC 0: 1
1: 2
2: 6
3: 14
4: 156
Right 925722070 2:6839154-6839176 GTTCCAGCTAAGTTTAGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 66
925722064_925722070 20 Left 925722064 2:6839111-6839133 CCCTGTTCCCTGAAGGGATGGTT 0: 2
1: 1
2: 7
3: 14
4: 143
Right 925722070 2:6839154-6839176 GTTCCAGCTAAGTTTAGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 66
925722067_925722070 12 Left 925722067 2:6839119-6839141 CCTGAAGGGATGGTTCTATGTTG 0: 1
1: 1
2: 0
3: 4
4: 112
Right 925722070 2:6839154-6839176 GTTCCAGCTAAGTTTAGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 66
925722066_925722070 13 Left 925722066 2:6839118-6839140 CCCTGAAGGGATGGTTCTATGTT 0: 1
1: 4
2: 4
3: 17
4: 139
Right 925722070 2:6839154-6839176 GTTCCAGCTAAGTTTAGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925722070 Original CRISPR GTTCCAGCTAAGTTTAGTCC AGG Intergenic
905721250 1:40204432-40204454 CTGCCAGCTAATTTTACTCCAGG + Intronic
911812901 1:102307055-102307077 GTGCCAGCAATGTTTAGTTCTGG + Intergenic
912366017 1:109134500-109134522 ATTCCTGCAAAGCTTAGTCCTGG + Intronic
922585416 1:226730793-226730815 GTTCCAGATTAGATTAGTACTGG - Intronic
1067855089 10:49785130-49785152 ATTGCAGCATAGTTTAGTCCTGG - Intergenic
1072161056 10:92766972-92766994 GTTCTAGCTCAATTTAGCCCAGG + Intergenic
1075452729 10:122563452-122563474 CTTCCTACTAAGTTTACTCCAGG - Intronic
1088988910 11:114934256-114934278 GTTCAAGTTAAGTTTTGTCATGG - Intergenic
1090860519 11:130648592-130648614 CTTCTAGCTAAGATTAGGCCTGG - Intergenic
1091645526 12:2269776-2269798 CTTCCCTCTAAGTTTAGCCCTGG - Intronic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1093796309 12:23316747-23316769 GTTCCAGGTAAGTATAGTAGAGG + Intergenic
1094655801 12:32418715-32418737 CTACCACCTAAGTTTACTCCAGG + Intronic
1101570001 12:105945133-105945155 CTTCCAGCAAAGCTTAATCCAGG + Intergenic
1111788920 13:92827798-92827820 CTTCCATCTAGTTTTAGTCCTGG - Intronic
1112377637 13:98858491-98858513 TTTCTAGCTAATTTTAGTCCTGG - Intronic
1113696003 13:112346018-112346040 CTTCCATCTAAGCTTAGTGCCGG - Intergenic
1116288981 14:43007530-43007552 GTTCTAGCTAGTTTTTGTCCAGG - Intergenic
1126332426 15:47547911-47547933 ATTCATCCTAAGTTTAGTCCAGG + Intronic
1126678852 15:51185015-51185037 GGTCCAGCTAAGATCAGTCCAGG + Intergenic
1135660468 16:24292143-24292165 GTGGCAGCTAAGTTTAGCGCTGG + Intronic
1138263534 16:55643299-55643321 GCTCCAGCTCAGTGTAGCCCAGG - Intergenic
1158537154 18:58318574-58318596 GTTACAGCTAAGTTTGCTCTTGG - Intronic
1160600990 18:80012558-80012580 GTTTCAGCTAGATTTAGTCCAGG + Intronic
925715002 2:6775783-6775805 GTGCCAGCCAAGCTTAATCCAGG - Intergenic
925722070 2:6839154-6839176 GTTCCAGCTAAGTTTAGTCCAGG + Intergenic
929092507 2:38233483-38233505 CTTCCAGATTAATTTAGTCCAGG - Intergenic
932587994 2:73044288-73044310 GTTCCAGCTTCCTTCAGTCCTGG - Intronic
932978617 2:76635069-76635091 ATTGCAGCTCAGTTTGGTCCGGG + Intergenic
933320451 2:80769660-80769682 GTTCCAGATAAATTTAATCAAGG - Intergenic
940192905 2:151061457-151061479 GGTCCAGTGAAGTTCAGTCCTGG - Intergenic
1170113736 20:12833945-12833967 GTACTAGATAAGTTTAGTTCAGG + Intergenic
1175492817 20:59390398-59390420 GTTCCAGCTACCTCTAGCCCTGG - Intergenic
1183125991 22:35782673-35782695 ATTCCAGCTAACTTTAGTACAGG + Intronic
1184045576 22:41970545-41970567 GCTACAGCAAAGTTTAGGCCAGG - Intergenic
950944830 3:16934333-16934355 GTTCCTGCTAAGCTGAGCCCTGG + Intronic
954938815 3:54352215-54352237 GTGCAAGCTAACTTTATTCCTGG + Intronic
959208424 3:103343441-103343463 TTTCCAGTTAAGTTTATTTCCGG - Intergenic
960989732 3:123302646-123302668 GCTCCAGCTCTGTTGAGTCCTGG + Intronic
961719062 3:128880066-128880088 GTTCCAGCTAAATTTTGTCAGGG + Intronic
968790252 4:2655633-2655655 GTGCCAGCTAAGTTTTGGCTTGG + Intronic
975924515 4:79432717-79432739 TTTCCAGCTATGTTAGGTCCTGG + Intergenic
983551503 4:169021966-169021988 GTTCCACTTAAGTTGAGTCTTGG + Intergenic
983919474 4:173330546-173330568 TTCCCAGGTAAGTTTAGTCATGG + Intergenic
988062677 5:26193742-26193764 GTCCCAGCTAAGTCCAGTCTTGG + Intergenic
991302511 5:65143007-65143029 GTTCCAGCTAACTTTAGAATTGG + Intergenic
993031198 5:82707743-82707765 GTTCCAGCTAAATTCATTTCAGG + Intergenic
996762758 5:127002899-127002921 GTAACAGCTAAGTTTTGGCCCGG - Intronic
1005032265 6:21521803-21521825 CTTTCAGGGAAGTTTAGTCCTGG - Intergenic
1010660475 6:78564900-78564922 GTTACAGCTAAGTAGATTCCAGG - Intergenic
1011320610 6:86088275-86088297 GTAGCAGCTAATTTAAGTCCAGG + Intergenic
1011972073 6:93237690-93237712 GTTCCTGTTAAGTTGGGTCCTGG + Intergenic
1014741561 6:125153725-125153747 GTTCCAGCTTGGTTTGGGCCAGG + Exonic
1015831060 6:137369404-137369426 GTTTCAGCTAAGTTTTGGCAGGG + Intergenic
1019560887 7:1656489-1656511 GTTCCAGTCCAGGTTAGTCCAGG - Intergenic
1023395224 7:39745690-39745712 GTTCCAGGTGATTCTAGTCCAGG + Intergenic
1023426261 7:40039766-40039788 GTTGCAGCTAATTTTTTTCCAGG + Intronic
1025597987 7:62955623-62955645 CTTCCATCTAGTTTTAGTCCTGG - Intergenic
1030675393 7:112380002-112380024 GATCCAACTAAATTTATTCCAGG + Intergenic
1046748710 8:117904201-117904223 ATTCCAGATAATTGTAGTCCTGG - Intronic
1047490868 8:125373635-125373657 TTTCCAGCAAAGTTTCTTCCAGG + Intergenic
1050786872 9:9414498-9414520 CTTCCTGGTACGTTTAGTCCAGG + Intronic
1050913846 9:11107334-11107356 GTGTCAGCTGAGTTTGGTCCGGG - Intergenic
1051007804 9:12368928-12368950 GTTCCAGATAAGAGTAGTTCAGG - Intergenic
1056870898 9:90277111-90277133 GTTCCAGCAAAGTATTTTCCCGG - Intergenic
1058285436 9:103171037-103171059 ATTCCATCTAAGTTTACACCTGG - Intergenic
1059764516 9:117371117-117371139 CATCCAGCTAGGTTTAGTCTTGG - Intronic
1186106633 X:6214555-6214577 TCTCCATCTATGTTTAGTCCTGG - Intronic
1198523940 X:137480869-137480891 GTTCTTGCTATGTTTAGGCCAGG + Intergenic
1198950844 X:142070313-142070335 ATGCCAAATAAGTTTAGTCCTGG - Intergenic
1200740491 Y:6848344-6848366 GTTTCAGCTCAGTTCTGTCCTGG - Intergenic
1201704856 Y:16925363-16925385 GTGCCAGCAATGTTTAGCCCAGG + Intergenic
1201957836 Y:19645766-19645788 GTTCCAGCTAGATTTAGTCTAGG + Intergenic