ID: 925722137

View in Genome Browser
Species Human (GRCh38)
Location 2:6839625-6839647
Sequence CTGGAGACTAAGAAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 2, 1: 0, 2: 4, 3: 40, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925722137_925722140 26 Left 925722137 2:6839625-6839647 CCTTGTTCCTTCTTAGTCTCCAG 0: 2
1: 0
2: 4
3: 40
4: 407
Right 925722140 2:6839674-6839696 CATACTGTTGCAATTATTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925722137 Original CRISPR CTGGAGACTAAGAAGGAACA AGG (reversed) Intergenic
903976493 1:27153826-27153848 CTGGAGCCTGAGAAGGACCAAGG + Intronic
904949913 1:34228608-34228630 CTGGAGAGCAACAAGGAACAAGG - Intergenic
905035247 1:34913990-34914012 AGGGAGAATAAGAAGGAAAAAGG + Intronic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906933813 1:50194639-50194661 CTGGAGACCAAGAAAGAAGCAGG + Intronic
907012917 1:50979734-50979756 CTGTCCACTGAGAAGGAACAGGG - Intergenic
907774784 1:57503320-57503342 CTAGAGACTGAGAAACAACAAGG - Intronic
908775899 1:67639648-67639670 TGAGAGACTAAGAAGGAAGAGGG + Intergenic
908801930 1:67889265-67889287 CTGGAGAGTGAGGAGGAACCTGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
910460302 1:87441927-87441949 CTGGAGAGGAAGAAGGATCAAGG + Intergenic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
911058954 1:93731532-93731554 CTGGAAAGGAAGAAGGTACAAGG + Intronic
911084705 1:93966668-93966690 CTGGAGACTCAGGAGGCACCTGG - Intergenic
913184774 1:116360242-116360264 CTGGAAACTCTGGAGGAACAGGG + Intergenic
914317532 1:146528194-146528216 CTGGAGAGGAGGAAGGATCAAGG + Intergenic
914496824 1:148205166-148205188 CTGGAGAGGAGGAAGGATCAAGG - Intergenic
914865924 1:151428548-151428570 CTAAAGACTAAGAAAGCACAAGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915414710 1:155732529-155732551 TTGGAGACAAAGAAGCATCAAGG - Intronic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916886966 1:169078888-169078910 CTGGAGACCAAGAAGGACATTGG - Intergenic
917695641 1:177520454-177520476 CTGGAAACCAAGAGAGAACATGG + Intergenic
920712135 1:208305309-208305331 AGGTAGACTAAGAAGGAATAGGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
923908139 1:238408933-238408955 CTTGGGAGTAAGAAGCAACATGG - Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065879190 10:30025124-30025146 CTGGAGACTGGGTAGGAAGAGGG + Intronic
1067141445 10:43660463-43660485 CTGGTGAGTTGGAAGGAACAAGG - Intergenic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1068459166 10:57304228-57304250 CTGGAGATTAGGGAGGAAAAAGG - Intergenic
1068635184 10:59340526-59340548 ATGGAGAGTCCGAAGGAACAAGG - Intronic
1069659867 10:70116574-70116596 CTGGAGAGCAAGGAGGCACAGGG + Intronic
1069851618 10:71409117-71409139 CTGTAGACTAAGAAGGCTCCTGG + Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071605619 10:86985757-86985779 CAAGAGACTCAGAAGAAACAGGG - Intergenic
1072464266 10:95648716-95648738 CTGGAGAATGAGAAGCCACAGGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073498998 10:103919009-103919031 CTGGAGACTAAGCACCATCAAGG - Intergenic
1073855715 10:107670980-107671002 CTGGAGACTGGGAAGAAAAAGGG + Intergenic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074526200 10:114265503-114265525 ATTGAGGCTAAGAAGAAACAGGG + Intronic
1076709054 10:132321074-132321096 CTGGAGAGTGGGATGGAACACGG + Intronic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1079188728 11:18260090-18260112 CTGGAGAGAATGAAGGGACAAGG - Intergenic
1079370546 11:19848383-19848405 ATGTAGCCTAGGAAGGAACATGG + Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1080426728 11:32161754-32161776 CTGATGATTAAGAAGGAAAATGG - Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084558281 11:69888127-69888149 CTGGACAGCAAGAAGGAGCAAGG - Intergenic
1084625909 11:70306864-70306886 CTGGAAACAAAGAAGGCTCAGGG - Intronic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087464988 11:98492990-98493012 CTAGAAACTAAAAAGGATCATGG + Intergenic
1088647373 11:111927524-111927546 CTGCACACTAAGAATGTACAAGG - Intronic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1089485268 11:118840830-118840852 TTAGAAACTAAGAAGGAACCGGG + Intergenic
1089537697 11:119170754-119170776 CTGGTGGCCAAGAAGGAAAAAGG + Intronic
1089633318 11:119796778-119796800 CTAGAGACCCAGGAGGAACAGGG - Intergenic
1089761442 11:120727204-120727226 CTGGAGAATATGCAGGAACGAGG - Intronic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1090110032 11:123897616-123897638 CTGGAGACCATAAAGGAAAATGG + Intergenic
1090888610 11:130901962-130901984 CTGAATACTGAGTAGGAACAAGG + Intronic
1091358583 11:134957218-134957240 CTGGAGACTAAGAAGCCCCATGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093013216 12:14129872-14129894 CTGGAGACAACGAATGAAAACGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1094057332 12:26280593-26280615 CTGGAGACTTGGAAGGATAAGGG + Intronic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1095389821 12:41692540-41692562 CTGGAGACTAACCAGACACAAGG - Intergenic
1096532165 12:52249015-52249037 CAGGAGACTGAGAAGGCACATGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1102042283 12:109808570-109808592 CTGAAGCCTTACAAGGAACAGGG + Intronic
1102200359 12:111053739-111053761 CGGGAGACCAACAAGGAACTGGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102767096 12:115443046-115443068 ATGGAGAGGAAAAAGGAACAGGG - Intergenic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103265887 12:119629755-119629777 ATGGAGACTACGAAGGAGCCAGG + Exonic
1104343795 12:127977460-127977482 CAGGACACTAAGAAGAAGCAAGG + Intergenic
1104442184 12:128802722-128802744 CTGAAGACTAAGGATGAAAAAGG + Intronic
1104519688 12:129461887-129461909 AGGAAGACTAAGAAAGAACAAGG + Intronic
1107632047 13:42352099-42352121 GTGGTGACAAAGAAGGCACAGGG + Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1109476882 13:62891014-62891036 CTGGAGTGGAAGGAGGAACATGG + Intergenic
1109901329 13:68776051-68776073 CTTGAAAATAAGAAGAAACAGGG - Intergenic
1112143256 13:96670111-96670133 AAGAAGACTAAGAAGGAGCAAGG + Intronic
1112684199 13:101804060-101804082 CCAGAGAATAAGAAGGAGCATGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113738222 13:112692965-112692987 GTGAACACCAAGAAGGAACAGGG - Intronic
1114276883 14:21154751-21154773 CTAGAGACTAAGAAGTGAGAAGG - Intergenic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114545804 14:23499673-23499695 AAAGAGACCAAGAAGGAACAGGG - Intronic
1114584892 14:23802168-23802190 CTCTAGACTAAGCAGGAACAGGG + Intergenic
1115087310 14:29533004-29533026 CTGGAGACAAGGAAGGATAACGG - Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115331099 14:32199402-32199424 TTGGAGATAAAGAAGAAACAAGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116402028 14:44519361-44519383 CTGGAAACCAAAAATGAACAAGG - Intergenic
1116768826 14:49103673-49103695 CTAGATTCTAAGAAGGAAAAAGG - Intergenic
1117058748 14:51939510-51939532 GTGGAGAGTAAGACGCAACATGG - Intronic
1118885993 14:69866237-69866259 CTGGAGAGGAAGAAGGACCCTGG - Intronic
1119706409 14:76785474-76785496 CTGGAGACCAAGAAGGGAAATGG - Intergenic
1120223661 14:81765562-81765584 CTGCAACCTAAGAAGGAAAATGG + Intergenic
1120689917 14:87581042-87581064 ATGCAGACAAAGAAGAAACAAGG + Intergenic
1123448172 15:20344532-20344554 CTGGAGACTAAGGAGAAGCAAGG - Intergenic
1123994408 15:25708306-25708328 TTGGAGAATAAGCAGAAACATGG + Intronic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124858023 15:33409819-33409841 TTGTAGACTAAAAAGGCACAAGG + Intronic
1125082337 15:35689634-35689656 CTCCACACTAAGAAAGAACAAGG - Intergenic
1125929574 15:43590628-43590650 CTGGAGACAAAAAAGAGACAAGG + Intergenic
1125942741 15:43690460-43690482 CTGGAGACAAAAAAGAGACAAGG + Intergenic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126636622 15:50786295-50786317 CTGGGGAATAGGAAGCAACATGG - Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127904760 15:63368407-63368429 CTGCAGTCTTAGAAGGAGCAGGG - Intronic
1128561115 15:68668370-68668392 CAGGAGACAAACAATGAACAAGG + Intronic
1129253877 15:74323054-74323076 CTGGAGACTTAGAAGGTAAGAGG - Intronic
1129262502 15:74376509-74376531 CTGGAGTCCAACAAGGATCAAGG + Intergenic
1129791049 15:78340778-78340800 CTGGAGAGCAAGGAGGATCAGGG + Intronic
1130357705 15:83149470-83149492 AAAGAGACTAAGAAGGAACAGGG + Intronic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138814130 16:60184535-60184557 CTGGAGTCTTAGAGGGAGCATGG + Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1140509946 16:75499751-75499773 CTGAAGACTCAGCAGGACCATGG - Intergenic
1141881765 16:86864944-86864966 CTGGAGATTAGAAAGGAACAAGG + Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1145102831 17:20090920-20090942 CTGGAGACCCATAAGGAATAGGG - Intronic
1146524776 17:33557175-33557197 ATGGAGACCAAAAAGGAAAAAGG - Intronic
1146556892 17:33832885-33832907 GTGGAGACTTAGAACCAACACGG + Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1148344807 17:46895971-46895993 CTGGGGATTAAGAAAGACCAAGG + Intergenic
1148845509 17:50527635-50527657 CTGCTCACTGAGAAGGAACAAGG - Intronic
1149369047 17:55974841-55974863 CTGGAGTCTAAGGAGGAATCAGG + Intergenic
1149569254 17:57660802-57660824 CTGGAGAATAAAATGCAACAGGG + Intronic
1150173778 17:63028141-63028163 CTGTAAACCAAGAATGAACAAGG + Intronic
1152026683 17:77814201-77814223 CTGGAGGATGAGAAGCAACATGG + Intergenic
1152340623 17:79722048-79722070 CTGGAGACTAAGGAGAAGCAAGG + Intergenic
1153502230 18:5761100-5761122 CAGGAGATTACCAAGGAACAGGG + Intergenic
1154496365 18:14964000-14964022 CTGGAGACTAAGAAGCCCCATGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156490189 18:37491553-37491575 CTGGAGACCAAGAGGGACTATGG + Intronic
1156633114 18:38994405-38994427 CTGGAGACTAAGCAGTACCAAGG - Intergenic
1157185367 18:45536081-45536103 CTGGACAATAAGAAGGAAAAAGG - Intronic
1157308172 18:46531992-46532014 CTGGTGACAAAAAAGGAAGATGG + Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1160017049 18:75152684-75152706 CTGGAGACAAAGAAATACCACGG + Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160827713 19:1088499-1088521 ATGCAGCCTCAGAAGGAACAAGG - Exonic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1162597493 19:11640260-11640282 TTGGAGACAAAGGAGGAACTGGG - Intergenic
1163431121 19:17268403-17268425 TTGGTTACTAAGAAGGAAGAGGG - Intronic
1164373546 19:27663346-27663368 GTGGAAACTATGAAGGAACATGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1166010120 19:39935430-39935452 GTGGGGACTGAGAAGGAACCAGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166953903 19:46448850-46448872 CTGGAGCCTCCAAAGGAACACGG + Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167805554 19:51781398-51781420 CTGGCTACTAAGAAGGAAATTGG + Intronic
1167941167 19:52946714-52946736 CTGGACACTAAGCGGGGACAGGG - Intronic
1168190207 19:54732831-54732853 CAGGAAACTAAGGAGGAACAAGG + Intronic
1168192436 19:54749199-54749221 CAGGAAACTAAGGAGCAACAAGG + Intronic
1168196762 19:54780476-54780498 CAGGAAACTAAGGAGCAACAAGG + Intronic
1168200357 19:54810699-54810721 CAGGAAACTAAGGAGCAACAAGG + Intronic
1168202544 19:54826892-54826914 CAGGAAACTAAGGAGCAACAAGG + Intronic
1168205119 19:54844733-54844755 CAGGAAACTAAGGAGGAACAAGG + Intronic
1168207356 19:54860947-54860969 CAGGAAACTAAGGAGCAACAAGG + Intronic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
925256683 2:2495605-2495627 CTGAAGAGTAAGTGGGAACAGGG + Intergenic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926408712 2:12579988-12580010 CTGGAGCCTAAGAGTGAATAAGG + Intergenic
926414184 2:12632884-12632906 ATGGAGCCTAAGAAGAAGCATGG - Intergenic
926553342 2:14327294-14327316 CTTGAGACTACTATGGAACATGG - Intergenic
926910426 2:17847855-17847877 CTGGAGGCTAAACAGGAAGAAGG - Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930682593 2:54273023-54273045 CAGGAAACTAGGAAGGATCAAGG + Intronic
930771671 2:55136179-55136201 ATGTACACTAAGAAGCAACAGGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931565999 2:63616237-63616259 CTGAAGAATAAGAAGGGAGAGGG + Intronic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932228648 2:70063876-70063898 GTAGAGTGTAAGAAGGAACAGGG - Intergenic
932285552 2:70528910-70528932 CTGAAGTGTAAGAAGGAACAGGG - Intronic
932993582 2:76819425-76819447 CTAGAAACTAAGAAAGAGCAAGG + Intronic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933469840 2:82707888-82707910 CTGTAGACTAAGTGGGATCATGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935728981 2:106049312-106049334 CTGAATACTAAGAACGTACATGG - Intergenic
936273086 2:111067597-111067619 CTAGAGACTAATAAGTAATATGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936482062 2:112893239-112893261 GTGGAATCTAAGAAGGAACCTGG + Intergenic
937541123 2:122955438-122955460 CTGGAGAATAAGAAAACACAAGG + Intergenic
937758292 2:125567487-125567509 GTGGAGAATAAGAATAAACAAGG + Intergenic
938641650 2:133287236-133287258 CTGGTGACTAAAATGGTACAAGG - Intronic
940450664 2:153832215-153832237 GTGGAGACTAACAAAGGACAAGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941372397 2:164681658-164681680 CTGGAAACTAAGAATAAACTGGG + Intronic
941660621 2:168192225-168192247 CAGCAGGCAAAGAAGGAACATGG + Intronic
941677721 2:168361886-168361908 CCTGAGACTAAGAAGGAATATGG - Intergenic
941727628 2:168880766-168880788 CTGGAGACTAGGGAGGCCCAAGG + Intronic
942160156 2:173176635-173176657 CAGGAGACTAAGAAGGACAGGGG + Intronic
943381440 2:187154352-187154374 ATGGAGAATAAGCAAGAACAAGG - Intergenic
943441866 2:187935279-187935301 CTGGAAACTAAGCCGGAGCAAGG - Intergenic
943774712 2:191752504-191752526 ATGGAGAATAAAAGGGAACATGG - Intergenic
944469082 2:200033632-200033654 CTGGAGTCGGAGAAAGAACAGGG - Intergenic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945580425 2:211587550-211587572 CTAGAGACTTAGAGGGAGCATGG + Intronic
946178368 2:217935591-217935613 CTGGAGGCTTAGAAGGAATTCGG - Intronic
946315781 2:218910980-218911002 CTGGAGACTTATAGGGAATAGGG + Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
948360779 2:237418655-237418677 CTGGAGACTGTGATGGAACTCGG - Intergenic
948766817 2:240226735-240226757 ATGGAGACTAAGAAAGACCCTGG + Intergenic
1168890187 20:1290355-1290377 CTGGAAGGGAAGAAGGAACAGGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169329648 20:4706308-4706330 CTGGTGGCTAAGAAGAAACTTGG + Intergenic
1169421829 20:5466601-5466623 CTTGAGACTGAGAAGGTGCAGGG - Intergenic
1170753290 20:19171751-19171773 GTAGACACTAAGGAGGAACAGGG + Intergenic
1171047079 20:21819435-21819457 CTGGAGACTAGGAAGGGTAAAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1173019640 20:39256225-39256247 CTTCAGACTAGGAAGGAAAAGGG + Intergenic
1173698014 20:45038387-45038409 CAGGAGACTAAACAGTAACAAGG - Intronic
1174531627 20:51219146-51219168 CTGGGGACTCAGAAGTAACCTGG - Intergenic
1174682249 20:52420025-52420047 CTGGACACTGAGGAAGAACAAGG - Intergenic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1177560484 21:22744486-22744508 CAGAAGACTAAGAAGAAGCAAGG + Intergenic
1177763255 21:25426879-25426901 CTGTATACTAAGTAGGAATAAGG + Intergenic
1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG + Intronic
1178760599 21:35398580-35398602 CTAGAGAGGAAGAAGGAATAGGG + Intronic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181933761 22:26425176-26425198 GGGGGGACCAAGAAGGAACAAGG - Intergenic
1182053264 22:27329335-27329357 CTGCTGCCTAAGAAGGAAGATGG - Intergenic
1182251804 22:29006556-29006578 CTGGAGACTGATAAGGAACCAGG - Intronic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
949127894 3:468499-468521 CAGGAGAATAAGAAAGAAAAAGG + Intergenic
951680337 3:25288232-25288254 CTGGAGAGAAAGGAGGAAAATGG + Intronic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952533992 3:34291120-34291142 CTGGAGACTACAATGGGACATGG + Intergenic
952769422 3:36984389-36984411 GAGGAGAGTGAGAAGGAACAGGG + Intergenic
953708066 3:45246067-45246089 CTGCAACCTAAGAAGGAAAATGG - Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954005349 3:47586268-47586290 CTGGAGTCCGAGAAGGAAAATGG - Exonic
954693389 3:52407664-52407686 GTGGACACTAGGAAGCAACATGG + Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955399272 3:58579669-58579691 TTGGAGAGTAAGAAGGATCCTGG + Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
955942882 3:64163465-64163487 CTGGAGACTAACAGAGAAAATGG - Intronic
958106335 3:89078196-89078218 CTTGAGATTAATAAGAAACACGG + Intergenic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
959585551 3:108022060-108022082 CTTGAGACAGAGTAGGAACAAGG + Intergenic
960485526 3:118248325-118248347 CTGAAGAGTAAGAATAAACATGG - Intergenic
961269906 3:125680826-125680848 CTGCAGACTAGGTATGAACATGG - Intergenic
963570668 3:146990968-146990990 TTGGAGAGTGAGAAGGCACAAGG - Intergenic
963741893 3:149089152-149089174 CTGGTGAGTAAGAAGGAAAGTGG + Intergenic
963811438 3:149780684-149780706 CTGTAGACTAAGAAGTCAAAGGG - Intronic
964074805 3:152680761-152680783 CTGGAGAATAAGAAGATAGAAGG + Intergenic
964276380 3:155012689-155012711 CTGGACAATAAGCAGGAAGAAGG - Intergenic
964604166 3:158541215-158541237 CTGAAGACTTAGAAGGAGCCAGG - Intronic
964972867 3:162582841-162582863 CTGGAGACAAGGAAGGGGCAAGG + Intergenic
965681570 3:171257174-171257196 CTAGAGACTTAGAAGAAGCAAGG + Intronic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
967839848 3:193996422-193996444 CTGGAGACTCAGCAGGCACCTGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
969166739 4:5322641-5322663 CTGGAGACTAAGAAAGGTCTAGG + Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970261836 4:14233017-14233039 TTGGAGACTTAGAATAAACATGG - Intergenic
971057912 4:22934446-22934468 CCAGAGACTAATAAGGATCATGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972027564 4:34404140-34404162 TTGGAAACTACTAAGGAACAGGG + Intergenic
973620195 4:52718480-52718502 CTAGAGACTGAGAAGGAAATTGG + Intergenic
973709477 4:53614232-53614254 CTGGAGAATATGTAGGGACAGGG - Intronic
974500825 4:62699807-62699829 ATGGAGACTAAGTGGGTACAAGG + Intergenic
975674998 4:76818572-76818594 ATGGAAACTAAAAAGGAGCAAGG - Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978886194 4:113768976-113768998 CAGGAGAATAAGAAATAACAGGG - Intergenic
980808033 4:137838278-137838300 CTGGGGACTAAGAAGCCAGATGG - Intergenic
981612707 4:146612642-146612664 ATGGACACGAAGAAGGTACAGGG + Intergenic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983666438 4:170189444-170189466 CTAGAAACAAAGAAGGAAAAGGG - Intergenic
984051757 4:174873088-174873110 CTGGAGGCTGAGAAGTCACATGG - Intronic
984583290 4:181534775-181534797 CTGGAGAGGAAGATGCAACAGGG - Intergenic
985576505 5:675714-675736 CTTGAGACCAGGAAGGCACAAGG - Intronic
986025799 5:3849640-3849662 CAGGATACTAATCAGGAACATGG + Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
987929048 5:24379772-24379794 CTGGAGATAAAGAAAGAATAGGG - Intergenic
988237406 5:28563056-28563078 CTGGATACTAAGAAAGAAACTGG + Intergenic
990782328 5:59379087-59379109 GTGAAGACCAGGAAGGAACAAGG - Intronic
991020459 5:61974506-61974528 CTGAAGGCTAAGCAGGAACATGG - Intergenic
991963713 5:72070694-72070716 CTGGAGAATAGCAAGGAGCAGGG + Intergenic
992154102 5:73937960-73937982 GTAGAAACCAAGAAGGAACATGG + Intronic
995318748 5:110806492-110806514 ATGGAAACTGAGAAGGAAAAGGG + Intergenic
997162566 5:131624726-131624748 TGGGAGACTGAGAAGGAAAAAGG + Intronic
997446758 5:133945975-133945997 CTGGAAGCTAAGAAGGCAGAGGG - Intergenic
999552427 5:152703979-152704001 CTGGAGAATAAGGAGAAATATGG + Intergenic
999738864 5:154534128-154534150 CTGGAGGCTGAGGAGGAAGATGG - Intergenic
1000177407 5:158770895-158770917 CTAAAGACTAAGAGGGAAAATGG - Intronic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1000422185 5:161050942-161050964 CTAGTGACTGGGAAGGAACATGG + Intergenic
1001653132 5:173329317-173329339 CTGGAGAGTAAAAGGGAACCCGG - Exonic
1002901453 6:1413045-1413067 CAGGAGACTTGGAAGGAGCAAGG + Intergenic
1003419064 6:5939432-5939454 CTGGTGACTGAGAAGGACCCGGG + Intergenic
1003893980 6:10589625-10589647 CTGGGGAGTAAGAAGCAACCAGG + Intronic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1005181429 6:23111877-23111899 GTGGAGACCTTGAAGGAACAGGG + Intergenic
1005438385 6:25838686-25838708 CTGAATAGCAAGAAGGAACAAGG - Intronic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006394764 6:33780113-33780135 CTGGATACTGAGCAGTAACAAGG - Exonic
1006734885 6:36266541-36266563 CTGGACAATGAGAAGTAACAGGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1009716847 6:67408622-67408644 GTGGAGACTTTGGAGGAACAGGG - Intergenic
1010841437 6:80652034-80652056 ACGGAGACTAGGGAGGAACAAGG + Intergenic
1011488620 6:87868705-87868727 CTGTAGACTAAAAAGGAGCATGG + Intergenic
1011580817 6:88862212-88862234 ATGGGGACTAGGAAAGAACATGG + Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1014401820 6:120999189-120999211 CTGGAGACTCGGGAGAAACATGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014986850 6:128021778-128021800 CTGGAGTTTTAGAAGGAGCAAGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017538148 6:155370835-155370857 TGGGAAACTTAGAAGGAACAGGG + Intergenic
1018031011 6:159841750-159841772 CAGGAGACATAGTAGGAACAGGG - Intergenic
1018573202 6:165232236-165232258 CTGGAGACTGAGATGAAAGAGGG - Intergenic
1018592887 6:165446817-165446839 CGGGAAAGAAAGAAGGAACAGGG + Intronic
1018703484 6:166446387-166446409 CTGTAGTCTCAGAAGGGACAAGG + Intronic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1022318379 7:29265087-29265109 CTAGAGACTTTGAAGGAATAGGG + Intronic
1022631866 7:32093011-32093033 CTGGGGACTAAGAGGGTTCATGG + Intronic
1023634747 7:42198368-42198390 CTGGAGAGTGAGAAGGATCCAGG + Intronic
1023923105 7:44645304-44645326 CTAAAGACAAAGAAGGTACAGGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027640243 7:80724102-80724124 CTCCAGAATGAGAAGGAACATGG + Intergenic
1027838132 7:83272713-83272735 TCGGAGACTCAGAAGGGACAGGG - Intergenic
1027942172 7:84696742-84696764 CTGGGGACTAATAGGGAGCAGGG - Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028979444 7:96951118-96951140 ATGGGGACTAGGTAGGAACAAGG + Intergenic
1029044354 7:97612373-97612395 CTGGATGCTAAGCAGGAAAAAGG + Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030626719 7:111853113-111853135 CACGGGACTAGGAAGGAACAAGG + Intronic
1030683443 7:112457241-112457263 CTTGAAACTAAGAAGGATTAGGG + Intronic
1031011850 7:116532924-116532946 CTGGACACCAAGGAGGAAGAAGG + Intronic
1031635012 7:124091869-124091891 CTGGAGCCAAATAAGTAACAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032209498 7:129900535-129900557 ATGGAGAGGAAGAAGAAACATGG - Intronic
1032697261 7:134348125-134348147 CTGGAGAGGAATAAGGAAAATGG - Intergenic
1032846950 7:135759187-135759209 CAGGAGACCAAGTAGGAAAAGGG + Intergenic
1033315448 7:140293384-140293406 GTGGAGAACAAGAAGCAACAGGG - Intergenic
1033670842 7:143491258-143491280 CTGGAGACTAAGCTGGAACAAGG + Intergenic
1033982813 7:147187118-147187140 CTGGGGAGAAAGAATGAACATGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1035006511 7:155666158-155666180 ATGGAGACTGAGAAGTTACACGG + Intronic
1035309597 7:157956991-157957013 CTAGAGAGTAAGAAGGAAAAGGG + Intronic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1039364633 8:36917000-36917022 GTGGAGACCAGGAAGGAAAAGGG - Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1041742862 8:61175745-61175767 CTAGACCCTAAGAGGGAACATGG + Intronic
1042944904 8:74144989-74145011 CTGGAGAATGAGAAGGGCCAGGG + Intergenic
1043510016 8:80941089-80941111 TTGGAAATTAATAAGGAACAAGG + Intergenic
1043548789 8:81344998-81345020 CTGCAGCCTGAGAAAGAACAGGG + Intergenic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1045596351 8:103660438-103660460 CTCGAGGCTGAGAAGGCACAGGG + Intronic
1046949669 8:120007897-120007919 CTGGAGACTGAGGAAAAACAGGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047489408 8:125362315-125362337 TTGGAGACGAAGGAGAAACAAGG + Intronic
1047814464 8:128447758-128447780 CTGGAGAGTAAGAAGGAGAGGGG + Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049910198 9:258542-258564 CAGGAGACTTAGAAACAACATGG + Intronic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1053304768 9:36976608-36976630 CTGCAGACTAAGAAAAATCAAGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053539047 9:38954685-38954707 CTGGAGAATAAGTTGGAAGAAGG + Intergenic
1054627094 9:67409234-67409256 CTGGAGAATAAGTTGGAAGAAGG - Intergenic
1057146266 9:92761239-92761261 CTTGAGACTGAGCAGGGACAAGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059993812 9:119890460-119890482 CTGGAGAATAAAAATGACCAAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060924309 9:127445187-127445209 CCGGAGAGTAACTAGGAACATGG + Exonic
1061070092 9:128304322-128304344 AAGGAGACTGAGAAGGAACCAGG + Intergenic
1061282182 9:129603799-129603821 CGGGAGGCTAAGCAGGAAGATGG - Intergenic
1061722485 9:132561382-132561404 CTGGAGACTAACAAGGCAAAAGG - Intronic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187604177 X:20865112-20865134 CAGGAGACGAGGAAAGAACATGG + Intergenic
1188087098 X:25913021-25913043 GTGGAGATGAAGGAGGAACATGG - Intergenic
1188234664 X:27713210-27713232 CAGGAAAATAAGAAGAAACAAGG + Intronic
1188342171 X:29017303-29017325 CTGTAGAATAAGAATGAACGTGG + Intronic
1188507435 X:30897741-30897763 ATGAAGACTATGAAGAAACATGG - Intronic
1188735703 X:33712298-33712320 CTGGATACTGAGAAGGGAAAGGG + Intergenic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189203561 X:39218570-39218592 GTGGAATCTAAGAAGAAACAAGG - Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1190237320 X:48626403-48626425 CTGGAGACTGAGAGGCCACATGG - Intergenic
1190463079 X:50698343-50698365 CTGGTGACTGAGAAGGGGCATGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192346753 X:70315749-70315771 CTTGAGACTAAGAAAGCACAAGG - Intronic
1192591563 X:72364235-72364257 AAGGAGACTGAGAAGGAACAGGG - Intronic
1193644035 X:84045236-84045258 ATTGAGACTACAAAGGAACAAGG - Intergenic
1195520385 X:105822566-105822588 CTGGAGACGAAGAAGCTAGAAGG - Exonic
1196515405 X:116605606-116605628 CAGGACTTTAAGAAGGAACATGG - Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199440565 X:147863486-147863508 CTGGAAACTAAGTAGGGAAAAGG - Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1200704930 Y:6434580-6434602 CTGTAGGCTGACAAGGAACATGG + Intergenic
1200803100 Y:7404322-7404344 CAGGAGAATGAGAAAGAACACGG - Intergenic
1201029181 Y:9730128-9730150 CTGTAGGCTGACAAGGAACATGG - Intergenic
1202028462 Y:20549451-20549473 CTAGAGACTAAGAAGAAACAAGG - Intergenic