ID: 925722469

View in Genome Browser
Species Human (GRCh38)
Location 2:6842459-6842481
Sequence GCAACTGTTCAGAGGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 6, 3: 22, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925722465_925722469 -6 Left 925722465 2:6842442-6842464 CCAGCAAAGCCACCACTGCAACT 0: 2
1: 5
2: 11
3: 33
4: 256
Right 925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG 0: 1
1: 1
2: 6
3: 22
4: 214
925722463_925722469 23 Left 925722463 2:6842413-6842435 CCTCATGCTCAACTTAGTCACTT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG 0: 1
1: 1
2: 6
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925722469 Original CRISPR GCAACTGTTCAGAGGCAAGC TGG Intronic
902845990 1:19111029-19111051 GCTTCTGTTCATAGGCAAGGCGG - Intronic
903615431 1:24651111-24651133 CCAACTTTTCAGAGGCAAAGAGG - Intronic
903967415 1:27099379-27099401 GCAACAGTTAAGAGCCCAGCAGG + Exonic
904501550 1:30915619-30915641 GCACCTGCTCAGAGGCACACAGG - Intergenic
905225120 1:36473766-36473788 GAAACTCTTCAGAGTGAAGCTGG + Exonic
908392382 1:63695490-63695512 GCACCTGCCCAGAGGAAAGCCGG + Intergenic
910486414 1:87719659-87719681 GCAACTGTGCAGAGGGGAGATGG + Intergenic
912090212 1:106063504-106063526 GTAACTGTTCAGAGGTATCCAGG - Intergenic
914005647 1:143729998-143730020 GCAACCTTTCAGTGGCCAGCTGG + Intergenic
914098113 1:144561244-144561266 GCAACCTTTCAGTGGCCAGCTGG + Intergenic
914800144 1:150955461-150955483 GCAAGTCTCCAGAGGCAGGCTGG - Intronic
914855466 1:151347142-151347164 GCGACTGTTCAGAGGTAGGGAGG - Intronic
914922821 1:151859139-151859161 GCTAAGGGTCAGAGGCAAGCTGG + Intergenic
915403265 1:155639845-155639867 GCAACTGCTTGGAGGCAGGCTGG + Intergenic
916115729 1:161483650-161483672 GCTACTGCTCAGAGGCATGCTGG + Intergenic
918072571 1:181143698-181143720 GCACCACTTCAGAGGCAGGCTGG - Intergenic
919757516 1:201075144-201075166 CCAAAGGTTCAGAGGCAGGCAGG - Intronic
921082184 1:211750222-211750244 GCAAAGGCTCAGAGGCAAGAAGG - Intronic
921957298 1:220998024-220998046 GGAACTCTCCAGAGGCAGGCTGG - Intergenic
922309536 1:224375209-224375231 GCAACTCTTGAGATGAAAGCAGG - Intronic
922685705 1:227637447-227637469 GCCAATGCTCAGAGGCAGGCAGG + Intronic
923649344 1:235858912-235858934 ACAAATGTACAGAGGCCAGCAGG - Intronic
924711575 1:246533852-246533874 GCAACTGCTCAGAGGCATACTGG - Intergenic
1063963626 10:11327741-11327763 GCAGCTTTTCAGAGGTAGGCTGG - Intronic
1064972875 10:21083833-21083855 GCAAATGTGCAAAGGCAAGTTGG + Intronic
1065132243 10:22633806-22633828 GCAACTGGGCATAAGCAAGCGGG + Intronic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1067769326 10:49112010-49112032 GCAAATGTTGTGAGGCAAGAGGG + Intronic
1068303729 10:55177513-55177535 GCAACTGCCCAGAGGCAGGCCGG - Intronic
1069922657 10:71826198-71826220 GCAACTATTCAGTGGCAATTTGG + Intronic
1071747891 10:88442647-88442669 GGAACTGTTGAGAGGAAAGGAGG - Intronic
1072426611 10:95335720-95335742 GCAACTTCTCAGAAGCAACCAGG - Intronic
1073280040 10:102347298-102347320 GCACCTGTTCAGAAGCTAGTTGG - Intronic
1074317933 10:112376057-112376079 TCAACTGTGTTGAGGCAAGCTGG + Intronic
1074822070 10:117187228-117187250 GCAACTGCACCGAGGCAAGAAGG - Intergenic
1074972511 10:118550719-118550741 GCAACTGGGCAGAGGCAGACAGG + Intergenic
1078172380 11:8938078-8938100 GGACCTGGTCAGTGGCAAGCGGG + Exonic
1078443809 11:11389211-11389233 CCAAGTCTTCAGAGGCAAGCAGG - Intronic
1078834773 11:15016753-15016775 GCACCTCTTCATAGGGAAGCAGG - Intronic
1079074429 11:17375011-17375033 GTAACTGCTCAGAGGCAAGCTGG - Exonic
1081446141 11:43133283-43133305 CCTACTGCTCACAGGCAAGCAGG + Intergenic
1081583924 11:44371282-44371304 GCACCTCTTCACAGGGAAGCAGG - Intergenic
1082082812 11:48025413-48025435 CCTACTGCTCAGAGGCCAGCAGG - Intronic
1088953191 11:114590743-114590765 GCAATTGCTCAGAGGCATGCTGG - Intronic
1090355111 11:126135305-126135327 GCAACAGTTCAGAGGGAGGGAGG - Intergenic
1090755091 11:129783602-129783624 GCAACTGCTCAAAGGCAAGCTGG + Intergenic
1091339284 11:134797893-134797915 GCAGCTGTGGAGAGGCGAGCGGG + Intergenic
1091699229 12:2649128-2649150 GCCACTGTTCCGCAGCAAGCTGG + Intronic
1092025314 12:5234727-5234749 GCAACGCTTCAGGGGAAAGCTGG + Intergenic
1093576505 12:20737163-20737185 GCAAATGTTCAGAGACAAAATGG + Exonic
1097260273 12:57715949-57715971 GCCTACGTTCAGAGGCAAGCCGG + Exonic
1097281019 12:57845710-57845732 GAAACTGGTCAGAGGCAGCCGGG + Intronic
1100172731 12:91994026-91994048 TCAACTGTTCAAAGGGAAGCAGG + Intronic
1101135525 12:101739452-101739474 GCGACGCTTCTGAGGCAAGCTGG + Exonic
1104741916 12:131183930-131183952 GCACCTCTTCACAGGGAAGCAGG + Intergenic
1104828712 12:131733518-131733540 TCCACTGCTCAGAGGCAAGGAGG - Intronic
1105303261 13:19153322-19153344 GCCACTGTTAAGAGGCTGGCGGG - Intergenic
1106197159 13:27503713-27503735 CCAACTATTCAGAGGAAGGCAGG + Intergenic
1111441522 13:88287183-88287205 GCACCTGTTCACAGGGTAGCAGG + Intergenic
1112844017 13:103615737-103615759 GCAACTGATCAGAAGGTAGCTGG + Intergenic
1115890564 14:38022974-38022996 GCAGCAGTTCAGAGGCAAGATGG + Intronic
1118071132 14:62247694-62247716 GTCACTTTTCAAAGGCAAGCAGG + Intergenic
1118805604 14:69234087-69234109 GCAACTGGTGATAGGCAAGCTGG - Intronic
1121016333 14:90551576-90551598 GCCATTGATCAGAGGGAAGCAGG + Intronic
1123768784 15:23508593-23508615 GCCACTGCTCAGAGGCAGGCTGG + Intergenic
1126527275 15:49670138-49670160 TCAAATGTTCATAGACAAGCAGG - Intergenic
1127818511 15:62634056-62634078 GCACCTTTACAGAGGCAATCAGG - Intronic
1128783673 15:70379359-70379381 GCAACTGTAGAGAGGCAACTTGG + Intergenic
1134227075 16:12399530-12399552 GCATCTCTTCAGAGGCAGGCTGG + Intronic
1135173920 16:20211176-20211198 GTAATTGTTCAGATGTAAGCAGG - Intergenic
1135460875 16:22641729-22641751 GCAATTGTCCAGATGAAAGCTGG - Intergenic
1135466767 16:22693352-22693374 TCACCTTTTTAGAGGCAAGCAGG - Intergenic
1139025083 16:62806086-62806108 GCAGCTTTTCACAGGCAAGAAGG - Intergenic
1140573939 16:76141256-76141278 GCAAGTGACCAGAAGCAAGCAGG + Intergenic
1142316846 16:89352727-89352749 ACACATTTTCAGAGGCAAGCGGG - Intronic
1142579438 17:932321-932343 GCAACAGTTCCCAGGCAACCCGG - Intronic
1145065660 17:19759759-19759781 GCAGATGTGCAGAGACAAGCAGG - Intergenic
1145239452 17:21231627-21231649 GCATTTCTTCAGAGGCACGCCGG - Intergenic
1147530917 17:41276193-41276215 GGAACTGATCAGCAGCAAGCAGG - Exonic
1148849732 17:50548753-50548775 GCAACGGGTCAGAGGGAGGCTGG - Intronic
1150026544 17:61681006-61681028 GCAACTTTTCACAGGGCAGCAGG + Intergenic
1152320323 17:79605311-79605333 GAAACTGTTCAGGGGCTGGCTGG + Intergenic
1153404262 18:4718437-4718459 AAAACTCTTCAGAGGCAAACAGG + Intergenic
1154219840 18:12442287-12442309 TCAAATGTTCAGATGCAGGCCGG - Intergenic
1155225077 18:23722289-23722311 GAAACAGCTCAGAGGGAAGCAGG - Intronic
1156078979 18:33312625-33312647 GCAACAGATCAAAGGCAAGGTGG - Intronic
1160064037 18:75558328-75558350 GCACCTGGTCAAAGGCAGGCTGG + Intergenic
1160235143 18:77079543-77079565 GTATCTCTTCAGAGGTAAGCAGG + Intronic
1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG + Intronic
1161542404 19:4859980-4860002 GGAGCTGATCAGAGGCATGCTGG + Exonic
1163127982 19:15254687-15254709 ACAGCTGTTCAGACGCACGCTGG + Intronic
1164090763 19:21949787-21949809 AAAACTGCTCAGAGGCAGGCTGG - Intronic
1164109903 19:22146482-22146504 AAAACTGGTAAGAGGCAAGCTGG - Intergenic
1164194875 19:22947612-22947634 AAAACTGCTCAGAGGCACGCTGG - Intergenic
1165261388 19:34622121-34622143 GTAACTGCTCAGAGGCAAGCTGG + Intronic
1165294452 19:34915464-34915486 GCCACTCTGCAGAGGCATGCAGG + Intergenic
1166426994 19:42687895-42687917 GCAACTGCTCAGAGGCATGCTGG + Intronic
1166610864 19:44194888-44194910 GAAAGTGTTCAGAAACAAGCAGG + Intergenic
1166853999 19:45773365-45773387 GCAGCGGTTCAGAATCAAGCTGG + Intronic
1166864476 19:45827687-45827709 GTACCTGATCAGAGGCAGGCAGG - Intronic
1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG + Intronic
925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG + Intronic
926040446 2:9668583-9668605 TGAACTGTTCAGAGGCACCCAGG - Intergenic
926238758 2:11069248-11069270 GCCATTGGTCAGGGGCAAGCTGG - Intergenic
926770907 2:16374342-16374364 GCATCTGTTCAAAGCCAACCAGG + Intergenic
928782069 2:34835289-34835311 GCAACTCTTCACAGGGCAGCAGG - Intergenic
928953791 2:36840246-36840268 TCAACTGATCAGAGGCCAGTGGG + Intergenic
929393635 2:41498152-41498174 GCAACTGGTTAGAGGCATGATGG - Intergenic
932660161 2:73644604-73644626 GCAACATTTCAGTGTCAAGCAGG + Intergenic
932758180 2:74423002-74423024 GGAAGTGTTTAGAGGCAAGTGGG - Intronic
933132712 2:78692502-78692524 GCACCTCTTCACAGGGAAGCAGG + Intergenic
933703649 2:85273943-85273965 GCTCCTGGTCAGAGGCCAGCAGG + Intronic
939052789 2:137328850-137328872 GCACCTCTTCACAGGGAAGCAGG - Intronic
940596037 2:155794792-155794814 GCACCTCTTCACAGGGAAGCAGG + Intergenic
940820272 2:158346348-158346370 GGAACTGTTCAGAGAAAAGTTGG - Intronic
940989637 2:160084697-160084719 GCAACTGCTCGGAGGCATGCTGG + Intergenic
941227359 2:162866079-162866101 GCATCTCTTCACAGGGAAGCAGG + Intergenic
945790029 2:214293473-214293495 GGTACTGTTCAGATGAAAGCTGG + Intronic
946925145 2:224619054-224619076 GTGACAGTTCAGAGACAAGCAGG + Intergenic
948118660 2:235512743-235512765 GCCACTGAGCAGAGGCAGGCAGG - Intronic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1171823167 20:29874085-29874107 TCAACAGATCAGAGGCGAGCGGG - Intergenic
1172128878 20:32642674-32642696 GCAGCTGGTCAGAGGCGGGCAGG + Intergenic
1172882065 20:38208579-38208601 GCTACTGTTCAGGGTTAAGCGGG + Intergenic
1174440481 20:50548121-50548143 GGAGCAGTTCAGAGGCAAGGGGG - Intronic
1174959230 20:55136321-55136343 GGAACTATTAAAAGGCAAGCAGG - Intergenic
1176448193 21:6840163-6840185 GCCACTGTTCACGGGGAAGCCGG + Intergenic
1176826363 21:13705185-13705207 GCCACTGTTCACGGGGAAGCCGG + Intergenic
1179143026 21:38743968-38743990 GGAACTGACCAGAGGCACGCTGG + Intergenic
1180579570 22:16818934-16818956 TCAACTGTTCAGAGGATAGGGGG - Intronic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1182395141 22:30030099-30030121 GCAGGTGTTCAGAGGCATGAAGG + Intronic
1183241866 22:36663724-36663746 GGTACTGTTCAGAGTCTAGCAGG + Intronic
1185109252 22:48891755-48891777 GTGACTGATCAGAGACAAGCTGG - Intergenic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
949416902 3:3824985-3825007 TCAACTGATCAAAAGCAAGCAGG - Intronic
954456771 3:50603854-50603876 GCACCTCTTCAGAGCCTAGCAGG - Intergenic
954784683 3:53084202-53084224 GAAAATATTCAGAGGGAAGCTGG - Intronic
956226018 3:66959462-66959484 AAAACCATTCAGAGGCAAGCAGG + Intergenic
965197585 3:165621435-165621457 GAGACTGCTCAGGGGCAAGCTGG + Intergenic
965302615 3:167021094-167021116 GCAACTCTTCACAGGGCAGCAGG - Intergenic
968643842 4:1728722-1728744 GCAACTGTTCAGCCGCTGGCTGG - Exonic
969043292 4:4317986-4318008 CCCACTGTACAGAGGCATGCTGG - Intronic
969499875 4:7546224-7546246 GCAACAGCTCAGAGGCATCCAGG + Intronic
976365611 4:84229615-84229637 GCAACTCTTCAAAGGGCAGCAGG + Intergenic
976921886 4:90452496-90452518 GCAACTGCCAAGAGGCAGGCTGG + Intronic
978860164 4:113439461-113439483 GAACATGTTCAGAGGAAAGCAGG - Intergenic
978975204 4:114860670-114860692 GTAACTGTCCAGAAGTAAGCAGG - Intronic
980650655 4:135711089-135711111 GCATCTCTTCAGAGGGCAGCAGG - Intergenic
981128795 4:141134848-141134870 GCAACTGCTCAGAACCTAGCCGG - Intronic
982509653 4:156265505-156265527 GCAACTCTTCACAGGGCAGCAGG - Intergenic
982904157 4:161047660-161047682 GCAACTCTTCACAGGGCAGCAGG + Intergenic
983990520 4:174113745-174113767 GAAACTGTTCTGAGCTAAGCTGG + Intergenic
984930016 4:184838768-184838790 GCAACTCTTCATAGGCTGGCAGG + Intergenic
985134808 4:186775552-186775574 TCAACTGTTGAGAGGGAAACAGG - Intergenic
986638830 5:9851684-9851706 GCAACTGTCCAATGGCCAGCAGG + Intergenic
987250359 5:16094599-16094621 GCAACTATTTAGAGCCAATCTGG - Intronic
988459131 5:31416839-31416861 GCAACTGTAGAGAGTTAAGCTGG + Intronic
991166277 5:63567684-63567706 GCAACTGCTCAGAGGCAGGGTGG - Intergenic
992179665 5:74183888-74183910 GAAACTGCACAGAGGCAAGAGGG + Intergenic
992197906 5:74357817-74357839 GCCACTGCTCAGGGGTAAGCAGG - Intergenic
994774892 5:104028491-104028513 GCAACTCCTCAGAGGCAGACTGG - Intergenic
995417021 5:111923649-111923671 GCAACTGCCCAGAGGCAGGCTGG + Intronic
995510702 5:112906364-112906386 AAAACAGTTCAGTGGCAAGCTGG + Intronic
995715743 5:115080559-115080581 GCAACATTTCAGAGGCATGCTGG + Intergenic
999248636 5:150168332-150168354 GCATCTGCCCCGAGGCAAGCTGG - Intronic
1005490618 6:26343998-26344020 GCCACTGACCAGAGGCAAGATGG - Intergenic
1009296133 6:61950334-61950356 GCATCTGTTCAGAAGGAAGTTGG - Intronic
1009626304 6:66142180-66142202 GCAACTGCCCAGAGACAGGCTGG + Intergenic
1010573822 6:77508936-77508958 GCAATGGCTCAGAGGCATGCTGG + Intergenic
1011700910 6:89953831-89953853 TCAACTGATCAAAGGCAGGCAGG + Intronic
1014214202 6:118737052-118737074 AAAACTTTTAAGAGGCAAGCTGG + Intergenic
1016072889 6:139761504-139761526 GAAACTTTTCATAGGCTAGCTGG - Intergenic
1016964787 6:149708948-149708970 GCAAAGATTCAAAGGCAAGCAGG + Intronic
1017574091 6:155782287-155782309 GTAACTGATCAGAAGCTAGCAGG - Intergenic
1017962270 6:159232942-159232964 GGAAGTGTCCAGAGGCAGGCCGG - Exonic
1019181244 6:170188418-170188440 GCAAAGGTTCAGAAGCAAGGGGG - Intergenic
1020763355 7:12293214-12293236 GCAACTGCCCAGAGGTAGGCTGG - Intergenic
1022974862 7:35547707-35547729 GCACCTGTGGAGAGGGAAGCCGG + Intergenic
1023629081 7:42145575-42145597 GAAACTGGTCTCAGGCAAGCAGG + Intronic
1024141304 7:46465804-46465826 GCAACTGTTTGGAGGAAAGCTGG + Intergenic
1024534486 7:50418711-50418733 GCCACGGTTAAGAGGCCAGCGGG - Intergenic
1026373235 7:69723021-69723043 AGAACTGTTCAGAAGCAAGAGGG + Intronic
1027881531 7:83844884-83844906 GCATCTGTGCAGATGAAAGCAGG + Intergenic
1028251393 7:88543252-88543274 GCAATGGCTCAGAGGCATGCTGG + Intergenic
1028914662 7:96244694-96244716 GCATGTGTTCTGAGGCCAGCAGG + Intronic
1031645720 7:124222539-124222561 GCACCTGTTCACAGGGAAACAGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034231301 7:149530686-149530708 GCAACTGCTCAGAAGCAGGCTGG - Intergenic
1034544283 7:151779660-151779682 GCTCCTAGTCAGAGGCAAGCAGG - Intronic
1037270255 8:17119820-17119842 TAAAATGTTTAGAGGCAAGCAGG + Intronic
1037337108 8:17801762-17801784 GCAGGTGGCCAGAGGCAAGCAGG - Intergenic
1038554497 8:28497809-28497831 GCAACTGTGAAGAGGAAAGCAGG - Intronic
1039010642 8:33089385-33089407 ACAACTGCTATGAGGCAAGCAGG + Intergenic
1040466112 8:47696890-47696912 GCATTTGCTCAGAGGAAAGCTGG - Intronic
1041582466 8:59477426-59477448 GCAACTGGGCAGAGGCCATCAGG + Intergenic
1041829077 8:62132467-62132489 GCACCTGGTCAGGGGCATGCTGG - Intergenic
1042091426 8:65163934-65163956 GCAACTTTACTCAGGCAAGCTGG - Intergenic
1044013980 8:87028253-87028275 GCAGCTCTTCTGAGGCAATCAGG + Intronic
1044114593 8:88319478-88319500 GCAACTGTTGAGAGTAAAGAAGG + Intronic
1044450777 8:92333973-92333995 GCATCTGTTCACAGGGGAGCAGG - Intergenic
1045076393 8:98573892-98573914 GCAACTCTTCAAAGGGCAGCAGG + Intronic
1047209823 8:122832359-122832381 GCCAATGCTCAGAGGCAGGCAGG + Intronic
1048266762 8:132994156-132994178 GCAACTGTTCAGGGGTGAGAAGG - Intronic
1049749909 8:144278167-144278189 GCCACTGGGCAGAGGCAGGCGGG + Intronic
1050926279 9:11267739-11267761 GCAACTGTTGGGAAGCAGGCTGG + Intergenic
1053045798 9:34916029-34916051 GCACCTCTTCACAGGGAAGCAGG - Intergenic
1053439034 9:38099473-38099495 GGTACTGTTCAGAGGAAAGATGG - Intergenic
1053749552 9:41237509-41237531 TCAACAGATCAGAGGCGAGCGGG + Intergenic
1054254996 9:62802389-62802411 TCAACAGATCAGAGGCGAGCCGG + Intergenic
1054336313 9:63813216-63813238 TCAACAGATCAGAGGCGAGCCGG - Intergenic
1056288634 9:85117715-85117737 CAAACTGTTCATAGGTAAGCTGG - Intergenic
1058406559 9:104682908-104682930 GCAAATCTTCAGAAGGAAGCAGG - Intergenic
1059478664 9:114570702-114570724 GAAAATGTTCAGAAACAAGCAGG + Intergenic
1059705828 9:116822441-116822463 GTGAATGTTCAGAGACAAGCAGG - Intronic
1061131881 9:128713068-128713090 GCAACTGTTCACAGCCCAGGAGG - Exonic
1061903681 9:133685685-133685707 CCAACTCTTCAGAGGCCAGAGGG + Intronic
1062451408 9:136617254-136617276 GCAACAGATCAGAGACAGGCAGG - Intergenic
1203520998 Un_GL000213v1:44355-44377 GCCACTGTTCACGGGGAAGCCGG - Intergenic
1203376242 Un_KI270442v1:380634-380656 TCAACAGATCAGAGGCGAGCAGG - Intergenic
1185513743 X:682773-682795 GCAACTTCTGAGATGCAAGCAGG + Intergenic
1186184052 X:7002763-7002785 GGAACTCATCAGAGGGAAGCCGG + Intergenic
1189151761 X:38716141-38716163 ATGACTATTCAGAGGCAAGCAGG - Intergenic
1190196396 X:48323046-48323068 GTAACGGATCAGAGGCCAGCTGG - Intergenic
1192140532 X:68644119-68644141 GCAACTGTGCACAGGCAAGCAGG - Intergenic
1192158924 X:68768551-68768573 GCAGCTGTTGAGGGGCAGGCTGG - Intergenic
1192960227 X:76122362-76122384 GCACCTCTTCAGAGGGCAGCAGG - Intergenic
1193348145 X:80428379-80428401 GCAACTTCTTAGAGGCAGGCTGG + Intronic
1193864876 X:86719612-86719634 GCAACTGTTCACAGGGCAGCAGG + Intronic
1194123740 X:89989852-89989874 GCAACTGCCCAGAGGCAGGCTGG + Intergenic
1196182289 X:112704995-112705017 GCATCTCTAAAGAGGCAAGCTGG - Intergenic
1199673483 X:150165815-150165837 GCAGGTGGTCAGAGGCAATCTGG - Intergenic
1200476626 Y:3647473-3647495 GCAACTGCCCAGAGGCAGGCTGG + Intergenic
1201065804 Y:10092945-10092967 TCAACAGATCAGAGGCAAGCGGG + Intergenic
1201337248 Y:12894145-12894167 GCAACTGCTCAGAGGCAGGCTGG - Intergenic
1201958209 Y:19649176-19649198 ACAACTGCTTGGAGGCAAGCTGG + Intergenic
1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG + Intergenic