ID: 925723224

View in Genome Browser
Species Human (GRCh38)
Location 2:6847874-6847896
Sequence AGCTAAATATTACATTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925723219_925723224 17 Left 925723219 2:6847834-6847856 CCTTGGAAATGCACTAGGAATTA 0: 1
1: 0
2: 0
3: 8
4: 161
Right 925723224 2:6847874-6847896 AGCTAAATATTACATTACCATGG 0: 1
1: 0
2: 1
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925723224 Original CRISPR AGCTAAATATTACATTACCA TGG Intronic
908343327 1:63205325-63205347 AGCTAAATATTCTATTAGTATGG - Intergenic
909101686 1:71357137-71357159 ATGTAAACATTACATTTCCATGG - Intergenic
910155327 1:84211312-84211334 AGATAACTGGTACATTACCATGG + Intronic
911037423 1:93565617-93565639 AGCCAATGAATACATTACCATGG - Intronic
913185468 1:116366821-116366843 AGCTAAATTTTTCATTAACTTGG + Intergenic
915883142 1:159694605-159694627 AGCTAAACACTACATTCCCCAGG + Intergenic
916670824 1:167018571-167018593 AGCAATATATGACAGTACCAAGG + Intronic
918384319 1:183990137-183990159 AGCTAAAAATTCTATTACTAGGG - Intronic
921534086 1:216323658-216323680 TGCTAAATGTGACATTGCCACGG + Exonic
1063604566 10:7510905-7510927 AGCTAAATATACAGTTACCATGG - Intergenic
1064029098 10:11871900-11871922 AACTAAATATTGCATTTCTAAGG - Exonic
1068257814 10:54536697-54536719 AGCTAAACATTGCATAGCCATGG - Intronic
1068365291 10:56041205-56041227 AACTAAAAAGTACATTACAAAGG - Intergenic
1068617247 10:59132649-59132671 AATTAAATATAACATTAGCAGGG + Intergenic
1069027000 10:63553478-63553500 AGCAAAATATTAAATTAACCTGG + Intronic
1069088700 10:64173285-64173307 AGATCAATAATACAGTACCAAGG + Intergenic
1069353557 10:67558194-67558216 AGATAAAAAATACATTTCCAAGG - Intronic
1078842055 11:15086723-15086745 AGACAAATAGTACATGACCAAGG - Intergenic
1079056276 11:17208744-17208766 ATCTAAAAATTACGTAACCATGG + Intronic
1079314131 11:19393188-19393210 AGCAAAATATTACAGTCCCCAGG - Intronic
1080270832 11:30449216-30449238 AGCTAAAAATTACATTAATCAGG + Intronic
1083649370 11:64192420-64192442 TCTTAAATATTACATTACAAAGG - Intronic
1085367841 11:75968581-75968603 ATCTAAATACTACATTAATATGG - Intronic
1086846499 11:91755996-91756018 AGCTAAACATTGAATAACCAGGG - Intergenic
1087553692 11:99687270-99687292 CGCTTAATATTATATTAACAAGG + Intronic
1087902473 11:103657194-103657216 AGCTAAAAAATAAATTACCCTGG + Intergenic
1089479975 11:118796694-118796716 AGCTATAAATTACATTCCCAGGG - Intergenic
1089956898 11:122579776-122579798 AGCTAAATATTCAATTAAAAGGG + Intergenic
1090097356 11:123755908-123755930 AGCTCAATATAACATTTCCAAGG + Intergenic
1093236298 12:16611471-16611493 AGCTACATATTTCTTTAGCACGG - Intergenic
1093595072 12:20949848-20949870 ATCTACATATTACAAGACCATGG + Intergenic
1096958907 12:55557491-55557513 AGCTAAATAATACATACACATGG - Intergenic
1098762353 12:74440653-74440675 AGTTCAATAATACATTACAAAGG + Intergenic
1102602550 12:114043045-114043067 ATCCACATCTTACATTACCATGG - Intergenic
1102633954 12:114306163-114306185 AGCTAAAGATTCCATTACTATGG + Intergenic
1104190181 12:126474319-126474341 AGCTAAATATTAGGTAATCATGG + Intergenic
1108109710 13:47055743-47055765 AGGTAATTATTCAATTACCATGG - Intergenic
1108576860 13:51798309-51798331 GGCTGAACATTACATCACCAGGG - Intronic
1109795685 13:67310237-67310259 AGCAAAATAGTACATGTCCATGG - Intergenic
1110777711 13:79429178-79429200 AGCTAAACATTCCATTACCATGG - Intergenic
1112144469 13:96682018-96682040 AGATAAATAATACATTTCCTTGG - Intronic
1116240280 14:42333367-42333389 AGCTAAAGATTACATTTCTCTGG - Intergenic
1119755567 14:77116029-77116051 AGTTAAATATGACATTTCCTAGG + Exonic
1202850181 14_GL000225v1_random:11740-11762 AGATAAATGTTACATCACCTGGG + Intergenic
1202852124 14_GL000225v1_random:28187-28209 AGATAAATGTTACATCACCTGGG - Intergenic
1202855243 14_GL000225v1_random:46219-46241 AGATAAATGTTACATCACCTGGG + Intergenic
1202859011 14_GL000225v1_random:69854-69876 AGATAAATGTTACATCACCTGGG - Intergenic
1202864878 14_GL000225v1_random:109870-109892 AGATAAATGTTACATCACCTGGG + Intergenic
1202866169 14_GL000225v1_random:119289-119311 AGATAAATTTTACATCACCTAGG - Intergenic
1202866663 14_GL000225v1_random:124073-124095 AGATAAATGTTACATCACCTGGG - Intergenic
1202867723 14_GL000225v1_random:133769-133791 AGATAAATGTTACATCACCTGGG - Intergenic
1202922416 14_KI270723v1_random:37407-37429 AGATAAATGTTACATCACCTGGG + Intergenic
1202922524 14_KI270724v1_random:207-229 AGATAAATGTTACATCACCTGGG - Intergenic
1129716488 15:77854448-77854470 AGCTGAATATTAACTTCCCAAGG + Intergenic
1131550325 15:93351489-93351511 AGCTAAAAATCACATCACCCAGG - Intergenic
1133558682 16:6929580-6929602 AGCTAAAAATTAAATTTCCCCGG - Intronic
1137541011 16:49361746-49361768 AGCTAAATATCACTTTAATATGG + Intergenic
1138252818 16:55517640-55517662 GGCTAAATATGACTTTGCCATGG - Intronic
1138897061 16:61219566-61219588 CGCTAAATACTACATAAGCATGG + Intergenic
1140620264 16:76721292-76721314 AGCTATATTTTTGATTACCATGG - Intergenic
1141241850 16:82272222-82272244 AGTTTAATATTATATTTCCATGG - Intergenic
1141377841 16:83548227-83548249 AGCTAAATAAGCCATCACCAAGG - Intronic
1146750918 17:35379208-35379230 AGCCAAAGATTTCATGACCAAGG - Intergenic
1146751058 17:35381017-35381039 AGCCAAAGATTTCATGACCAAGG + Intergenic
1149813212 17:59697943-59697965 AGCCAAATATTCCATAACCAAGG + Exonic
1150115500 17:62545454-62545476 AAATAAATATTACATTAGCCAGG + Intronic
1151305247 17:73258951-73258973 AGTTAAATGTAACATTTCCATGG - Intronic
1153179586 18:2417912-2417934 ATCTAAATATAACAATACCTGGG + Intergenic
1154488574 18:14900610-14900632 AGCTAAAAATTCTATTGCCATGG - Intergenic
1155982771 18:32197938-32197960 AGCTAAATATTGCATAGACATGG - Intronic
1158875234 18:61727655-61727677 AGCTATAAATTACATGAACAGGG - Intergenic
1158980830 18:62759887-62759909 AACTATATATTTCATTCCCAGGG - Intronic
1158991230 18:62871289-62871311 AGCTAAATTTGAATTTACCAGGG - Intronic
1159210262 18:65311716-65311738 AGCCAAATATTCTATTACTATGG - Intergenic
1159310992 18:66708698-66708720 AAATAAATATTACTTTATCATGG - Intergenic
1159637194 18:70819784-70819806 AGCTAAATAAAACAATACCATGG + Intergenic
1160633076 18:80259977-80259999 AGATAAATTTTACATTTCAATGG - Intergenic
1162056386 19:8066505-8066527 AGCTAAAAATTGCATACCCATGG + Intronic
925723224 2:6847874-6847896 AGCTAAATATTACATTACCATGG + Intronic
925772273 2:7294411-7294433 AGCTTAATATGACTTTACGAAGG + Intergenic
927016842 2:18972798-18972820 ATCTTAATATTATATTACTAAGG + Intergenic
929318921 2:40516046-40516068 AGACAAATATTAAATTGCCAAGG - Intronic
929641074 2:43580557-43580579 AGCTAAGACTTTCATTACCAGGG + Intronic
930145359 2:47996867-47996889 AGCTAAAAATTCCATTACTATGG - Intergenic
935199072 2:100840256-100840278 ATCTAAATTTTACAGTTCCAAGG + Intronic
939211233 2:139177497-139177519 AACTAAATATTACATCAAAAAGG - Intergenic
939323424 2:140654330-140654352 AGCAAATTATGACATTAACAAGG + Intronic
941210811 2:162636699-162636721 AGCAATATATTTCATTAACATGG + Intronic
941735789 2:168974758-168974780 AGCTAAAACTTATATTACAATGG - Intronic
942846605 2:180433725-180433747 AGCTAAAATTTCCATTACCATGG - Intergenic
943225546 2:185169543-185169565 AGCTAAACATTACATACACATGG - Intergenic
943585752 2:189737551-189737573 AGTAAAATATGACATTACTAGGG - Intronic
944552125 2:200854138-200854160 AGTTAAATAGTAGATTACCTTGG - Intronic
946914070 2:224498047-224498069 AGCTAGATATTAAATGACAAAGG + Intronic
1169599182 20:7237396-7237418 ATCTGAATCTTAGATTACCATGG - Intergenic
1169821977 20:9721814-9721836 AGCTAAATATTACCTTTACCTGG - Intronic
1172577951 20:36023750-36023772 AGCTCAATATTGCATTCCCCAGG + Exonic
1174540190 20:51283360-51283382 AGCTACATTTTCCATTACAAGGG + Intergenic
1176968598 21:15239672-15239694 AGCTAACTATTACATTGCATTGG + Intergenic
1179260027 21:39749947-39749969 AGCTACAATTTACATTGCCAGGG + Intronic
1184251873 22:43265161-43265183 GGCTTAATATTCCATTACCCAGG - Intronic
1184515801 22:44961465-44961487 AGCTAAACATTAGATTCACAGGG - Intronic
949299113 3:2562432-2562454 AGCTAAATATTGCATATCCAGGG - Intronic
949903187 3:8836996-8837018 AGCAAACCTTTACATTACCATGG + Intronic
951169629 3:19525565-19525587 TGATAAATAATAGATTACCATGG + Intronic
951622821 3:24625058-24625080 AGGTAATTATTCAATTACCACGG + Intergenic
954323213 3:49846056-49846078 AGCTAAATTTTAGATTAGGAGGG + Intronic
956496160 3:69828617-69828639 AGATAAATATAAAATCACCATGG + Intronic
957516585 3:81261883-81261905 AGCAAGACATTACATTACCAAGG + Intergenic
957689006 3:83543431-83543453 AGCTAAATATGACAAACCCACGG - Intergenic
958083611 3:88778847-88778869 AGCTATATATTACAGACCCATGG + Intergenic
962510288 3:136092511-136092533 AGCTGAATATTAAATTCCTATGG + Intronic
962705032 3:138034955-138034977 AGCTCAAAATTACATAACCAAGG - Intergenic
963498835 3:146099700-146099722 ATTAAAATATTATATTACCAAGG + Intronic
967549827 3:190778688-190778710 AGTTAAATATTAGATAGCCATGG + Intergenic
968195133 3:196700160-196700182 AGCAAAAAATTCCATTAACAAGG - Intronic
970425659 4:15943766-15943788 AGCTAAATATTAGGTAAGCATGG - Intergenic
970515558 4:16826412-16826434 ACATAAATATTACCTTACCTGGG + Intronic
971953580 4:33386394-33386416 AGCATAATATTACATTAGAAAGG + Intergenic
973203996 4:47539333-47539355 AGCTATATTTTACATTTGCATGG - Intronic
974558678 4:63488184-63488206 AGCTAAATATGAGAATTCCATGG + Intergenic
974729390 4:65842042-65842064 AGCTAAATATCTCATCACCTGGG + Intergenic
976035779 4:80818790-80818812 AGATAAATAGTACATTTGCATGG - Intronic
976331800 4:83840886-83840908 ATCTAAATATGTCATTACTATGG - Intergenic
976896261 4:90115789-90115811 AGCAAACTGTGACATTACCACGG - Intergenic
977644128 4:99392461-99392483 CGCTTAATATTATATTCCCAAGG - Intergenic
978408799 4:108407080-108407102 AGGTAATTATTCAATTACCATGG - Intergenic
978977694 4:114898764-114898786 ACCTAAATATTTCATTTTCAGGG + Intronic
979022251 4:115518095-115518117 AGCTAAATATAACATTTCCTTGG + Intergenic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
981959227 4:150515193-150515215 AGAACAATATAACATTACCAAGG + Intronic
983096511 4:163568699-163568721 AGATAAATATTCCTTTCCCAAGG - Intronic
985200514 4:187480103-187480125 AGCTAATTATAACATTACTCAGG + Intergenic
986833983 5:11613817-11613839 AGCTTAATATCACCCTACCAGGG + Intronic
988559050 5:32263774-32263796 AGCTATAAATTACTTTTCCAAGG - Intronic
988819815 5:34871320-34871342 ACCTAAATATTTCATTTGCAGGG - Intronic
989387716 5:40869814-40869836 GGCTACATATTACATAACCTGGG - Intergenic
989909058 5:49600620-49600642 AGATAAATGTTACATCACCTGGG + Intergenic
990443483 5:55869917-55869939 AGCTAAATCTCACATTGCAAGGG + Intronic
990924066 5:60999177-60999199 AGTTAAACATTGAATTACCATGG + Intronic
993136717 5:83976874-83976896 AACTCAATATTATATTACTAAGG + Intronic
994079312 5:95688656-95688678 AGCTAAATAATGCATAAACATGG + Intronic
994187324 5:96829602-96829624 AGCTCAATATTAAATTAGCGAGG + Intronic
994915849 5:105977934-105977956 AGCTAAGTATTAAAATACCCGGG + Intergenic
995033292 5:107504596-107504618 ATCTAATTACTACATTACCCTGG + Intronic
995638244 5:114220340-114220362 ATCTAAATGCTACTTTACCATGG + Intergenic
995671469 5:114609093-114609115 AGGGAAATACTACATCACCAAGG - Intergenic
996431525 5:123384699-123384721 ATCTGAATATTACAATACCATGG + Intronic
997154247 5:131535582-131535604 AGCTAAAGATTTCATTAATAAGG - Intronic
997289410 5:132716340-132716362 AGGCAGAAATTACATTACCAAGG + Exonic
998962118 5:147499404-147499426 ACCTAAGTATTTCATTTCCAGGG - Intronic
999558410 5:152771510-152771532 AGGTAAACATTATATAACCATGG - Intergenic
1002967696 6:1983317-1983339 AGGTAAAGATTTCATGACCAAGG + Intronic
1004754700 6:18599353-18599375 GTCTAAATATTACATTATCATGG + Intergenic
1006575045 6:35038967-35038989 AGTTAAATAATATATTACCATGG - Intronic
1006705165 6:36013897-36013919 AAATAAATATGACTTTACCAAGG + Intronic
1008380219 6:50832880-50832902 AGATCAATATTTCATTAACATGG - Intronic
1010494961 6:76522735-76522757 AACTGAAAGTTACATTACCATGG - Intergenic
1010984477 6:82407829-82407851 TGCAAAAATTTACATTACCAAGG - Intergenic
1011216005 6:85006212-85006234 TGCTAAATGTTACATGCCCAAGG - Intergenic
1012773630 6:103475921-103475943 AACTAAACATTTCAATACCAAGG - Intergenic
1013013260 6:106138640-106138662 AGATAACTAGTACATCACCAGGG - Intergenic
1014386469 6:120808425-120808447 AGTGAAAGATTAAATTACCAGGG + Intergenic
1015876347 6:137826477-137826499 AGCTAAATATTACGTAAGCATGG + Intergenic
1016130834 6:140467491-140467513 GGGTAAATATTACATTCACAAGG + Intergenic
1017665630 6:156718046-156718068 AGATAAATATTACCTTACACTGG - Intergenic
1020547127 7:9546580-9546602 AACTAAATATAAAAGTACCAGGG + Intergenic
1020702810 7:11504372-11504394 AGTATAATATTACATTACCCAGG - Intronic
1021037079 7:15812725-15812747 AGCTAAATATTGGATTCTCATGG - Intergenic
1021478608 7:21091131-21091153 AGCTAAATACTACATTTCCTGGG - Intergenic
1022781959 7:33594748-33594770 AGCAAAATGTTCCATTCCCAAGG + Intronic
1023110287 7:36803473-36803495 AGAAAAATATTACATTATTAGGG - Intergenic
1028082618 7:86598236-86598258 AGCTAAATATTTCATCATCTTGG + Intergenic
1028131952 7:87185976-87185998 AAGTAAGTAATACATTACCAGGG - Exonic
1030672790 7:112355230-112355252 AGCTCAACATTACATCATCAGGG - Intergenic
1031378218 7:121053114-121053136 TGTTAAATCTTACATAACCATGG + Intronic
1031445038 7:121842999-121843021 AGCCCAATATTAAATTATCAAGG - Intergenic
1032045226 7:128601146-128601168 AAATAAATATTACATTAGCCAGG + Intergenic
1036109500 8:5882022-5882044 AGATAATTATCAGATTACCAAGG + Intergenic
1038106380 8:24439717-24439739 AGCTAAATAGTATATTTCAAGGG + Intergenic
1039014914 8:33136612-33136634 AGCTTTATATTACAATACCACGG + Intergenic
1041336530 8:56790930-56790952 GGATAAATATCACATGACCACGG - Intergenic
1041396309 8:57395198-57395220 AGGTAAAGATTACATTTCCCAGG + Intergenic
1041594485 8:59632130-59632152 AGCTAAATATTATATTTTCTGGG + Intergenic
1041683377 8:60617367-60617389 TACTAAATAATACATTATCATGG + Intronic
1042965560 8:74348195-74348217 AGCTAAAATTTCTATTACCACGG + Intronic
1043054823 8:75424230-75424252 TGCTAAATATTACTTTAATAAGG - Intronic
1043097515 8:75994425-75994447 AGCTAAATGTCACATTTCAAAGG + Intergenic
1044527865 8:93272152-93272174 AGATAAATATTACAGTACTTTGG + Intergenic
1044913227 8:97084338-97084360 AGCAAAAGATCACATTGCCACGG - Intronic
1046572938 8:115989573-115989595 AGGTAATTATTACATTAAGATGG + Intergenic
1048921802 8:139238194-139238216 GACTAAATAAAACATTACCATGG - Intergenic
1050702932 9:8361575-8361597 AGGTAAATATTCAATTTCCATGG - Intronic
1050704199 9:8378029-8378051 AGCTAGATATTAAATTCACAAGG + Intronic
1054962074 9:70980135-70980157 ATGTAAATATTTCATAACCAGGG - Intronic
1054970949 9:71086137-71086159 AGCTAAACATTACATACTCAAGG + Intronic
1054996280 9:71394360-71394382 AACTAAAAATTACCTCACCAAGG - Intronic
1054998469 9:71421151-71421173 AGCTAAATATTGGATAAACATGG + Intronic
1055159767 9:73111793-73111815 AGCTACAACTTACATCACCAAGG - Intergenic
1056162944 9:83915980-83916002 ATCTAAATATTAAATAACCAGGG + Intronic
1056357405 9:85815555-85815577 ATCTAAATATTAAATAACCAGGG - Intergenic
1058331871 9:103771809-103771831 AGCTAAATAATACATACACAAGG - Intergenic
1060349004 9:122841224-122841246 AGCTAAAGACACCATTACCATGG + Intergenic
1203737046 Un_GL000216v2:146498-146520 AGATAAATGTTACATCACCTGGG + Intergenic
1203737663 Un_GL000216v2:152152-152174 AGATAAATGTTACATCACCTGGG + Intergenic
1203738180 Un_GL000216v2:156937-156959 AGATAAATTTTACATCACCTGGG + Intergenic
1203739466 Un_GL000216v2:166352-166374 AGATAAATGTTACATCACCTGGG - Intergenic
1185850347 X:3480178-3480200 TTCTAAATATTACATTACTTTGG - Intergenic
1186845858 X:13530330-13530352 AGCAAAATGTTACATTGCTATGG - Intergenic
1188089477 X:25945517-25945539 AGATAAATTTAACTTTACCATGG - Intergenic
1188709591 X:33379007-33379029 AGCTAGATATTACTTTATCATGG - Intergenic
1190391310 X:49934536-49934558 ATCAAAATATGACATTACTAAGG - Intronic
1191137490 X:57082019-57082041 AGCTAAATATTAAATACACATGG + Intergenic
1191162379 X:57344236-57344258 AGAAAAATATTCCATTATCATGG - Intronic
1192431552 X:71115863-71115885 AGCAAAATAAAACATTAGCAGGG - Intergenic
1192962086 X:76142140-76142162 AGCTACATCATACATGACCACGG - Intergenic
1192963447 X:76152947-76152969 AGCTACATCATACATGACCACGG + Intergenic
1193407367 X:81119230-81119252 ACCAAAATATTAGATTAACAAGG + Intronic
1195664400 X:107415784-107415806 AGCTAAAGTTTATATTACAATGG + Intergenic
1196204124 X:112919782-112919804 AGTTTAAAATTACTTTACCAAGG - Intergenic
1196626816 X:117886161-117886183 AGCTAAATAATACATTCACAAGG - Intergenic
1196682718 X:118485073-118485095 AGCTAAATAATGCATTCACATGG - Intergenic
1196742504 X:119037524-119037546 AGCTAAATAATGCATTCACATGG - Intergenic
1196888280 X:120267898-120267920 AGCTCATTAGTACACTACCATGG - Intronic
1197801279 X:130352119-130352141 AGCTAAATATTGCATACTCATGG - Intronic
1199502262 X:148520360-148520382 AGCTAAATATGACTTTTTCATGG - Intronic
1200850740 Y:7880684-7880706 AGCAAAATATCACATCACCTGGG + Intergenic
1201177501 Y:11318273-11318295 AGATAAATGTTACATCACCTGGG + Intergenic
1201177623 Y:11319366-11319388 AGATAAATGTTACATCACCTGGG + Intergenic
1201178579 Y:11324635-11324657 AGATAAATGTTACATCACCTGGG + Intergenic
1201896237 Y:18995439-18995461 ATGTAAATATTACATTGTCATGG + Intergenic
1201987581 Y:19986416-19986438 AACTAAATTTTACCTTGCCAAGG + Intergenic
1202624456 Y:56843124-56843146 AGACAAATGTTACATCACCAGGG - Intergenic