ID: 925730706

View in Genome Browser
Species Human (GRCh38)
Location 2:6917886-6917908
Sequence GCGCGGGCGCCGCCTGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925730706_925730716 0 Left 925730706 2:6917886-6917908 CCTCTCGCAGGCGGCGCCCGCGC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 925730716 2:6917909-6917931 CCCAGGGCAGTGGGCGCTTAGGG 0: 1
1: 0
2: 1
3: 13
4: 184
925730706_925730714 -1 Left 925730706 2:6917886-6917908 CCTCTCGCAGGCGGCGCCCGCGC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 925730714 2:6917908-6917930 CCCCAGGGCAGTGGGCGCTTAGG 0: 1
1: 0
2: 2
3: 25
4: 202
925730706_925730709 -10 Left 925730706 2:6917886-6917908 CCTCTCGCAGGCGGCGCCCGCGC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 925730709 2:6917899-6917921 GCGCCCGCGCCCCAGGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 274
925730706_925730720 30 Left 925730706 2:6917886-6917908 CCTCTCGCAGGCGGCGCCCGCGC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 925730720 2:6917939-6917961 GTCCCCCTGCCTGCCCTGCGCGG 0: 1
1: 1
2: 0
3: 37
4: 356
925730706_925730710 -9 Left 925730706 2:6917886-6917908 CCTCTCGCAGGCGGCGCCCGCGC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 925730710 2:6917900-6917922 CGCCCGCGCCCCAGGGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 121
925730706_925730718 6 Left 925730706 2:6917886-6917908 CCTCTCGCAGGCGGCGCCCGCGC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 925730718 2:6917915-6917937 GCAGTGGGCGCTTAGGGACCTGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925730706 Original CRISPR GCGCGGGCGCCGCCTGCGAG AGG (reversed) Intronic
900162771 1:1232214-1232236 GCGCAGGCGCCGCCGGCTCGGGG - Intergenic
900671296 1:3856801-3856823 GCGCGGGCGCCGCGGGGGCGCGG - Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903184711 1:21622535-21622557 GCGGCGGCGCTGCCTGCGATGGG + Intronic
903829122 1:26164415-26164437 CCGCCGCCGCCGCCTGCGAGGGG + Intergenic
904500154 1:30908594-30908616 GCGCGGGCGCGGGCGGCGGGCGG + Exonic
904641962 1:31937955-31937977 GCGCGGGGGCCGCCCGGGAGGGG + Intronic
905670805 1:39788927-39788949 GCGGGGGCGGGGCCTGGGAGCGG + Intergenic
905670812 1:39788946-39788968 GCGGGGGCCACGCCTGCGAGGGG + Intergenic
910771327 1:90835545-90835567 TCGCGGGCGCCGCTTGAAAGTGG - Intergenic
910930924 1:92441965-92441987 GTGGGGGCGGCGCCTGCGCGGGG + Intergenic
911696573 1:100896023-100896045 GCGCAGGCCCCGCCCGCGACCGG + Intergenic
917442424 1:175079405-175079427 GGGAGGGCCCCGCCTGCGAGCGG + Exonic
918066603 1:181105667-181105689 GCGCTGGGCCCGCCGGCGAGAGG + Intergenic
924732401 1:246724222-246724244 GCGCGGGAGCCGCGGGTGAGCGG - Exonic
1064028805 10:11869991-11870013 CCGCGGGGGACGCCGGCGAGGGG + Exonic
1065660249 10:27998816-27998838 AGGCGGGCGCCGACTGCGGGGGG - Intronic
1070933880 10:80278845-80278867 GCGCTGGCGCTGTCTGCTAGTGG + Intronic
1073076794 10:100829403-100829425 GCGCGGGGCACGCCCGCGAGGGG - Exonic
1077124311 11:925702-925724 GCGGGGGCGCCCCCTGCAGGCGG - Intronic
1077867426 11:6234656-6234678 GCGGGGGCGCGGGCTGCGTGTGG - Exonic
1078210415 11:9265402-9265424 GCGCAGGCGCCGTCTGGGAGGGG + Intergenic
1079035217 11:17014479-17014501 GCGGGGGCTCGGCCTGCGCGTGG + Intergenic
1081672849 11:44951051-44951073 GCGCGTGCGCCCCCTGCAGGCGG - Intronic
1081700017 11:45146949-45146971 GCGCGGGGGCCGCCGGTGCGGGG + Intronic
1081938194 11:46918706-46918728 CCGCCGGCGCCTCCTGCGCGGGG + Intergenic
1083899781 11:65638089-65638111 GCGCCGGCTCCGCCTGGGGGCGG - Intronic
1084146182 11:67266525-67266547 GGGGCGGCGCCGCCTGTGAGCGG + Exonic
1086981063 11:93198011-93198033 CGGCGGGCACCGCCGGCGAGGGG + Intergenic
1090385488 11:126355700-126355722 GCGCGGGTCCGGCCTGGGAGCGG - Intronic
1092163606 12:6329485-6329507 GAACGGGCGCTGCCTGCGCGAGG - Exonic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092743218 12:11649803-11649825 GCGGGGGCGCCGGCTGCGGGTGG + Intergenic
1095465516 12:42484111-42484133 GGGCAGGCGCCGCCCGCGGGCGG - Intronic
1097019148 12:56007699-56007721 GCGCGCGCGCAGGCTGTGAGGGG - Exonic
1104459702 12:128945279-128945301 CAGCGGTCGCCGCCTGCTAGTGG - Intronic
1106776733 13:33016518-33016540 GGGCGGCCGCCGCCTGCGTGCGG + Exonic
1110219651 13:73059495-73059517 GCGCGGGCTGCGCCTGCGGGCGG - Exonic
1113082791 13:106535416-106535438 GCGCGGGCGCCGCGTCGGCGCGG + Intergenic
1113437853 13:110307215-110307237 GCGCGGGCGGCGCCTCAAAGGGG + Intronic
1113779770 13:112969314-112969336 GCACGGGGGGCGCCTGCGGGTGG - Exonic
1116849450 14:49893431-49893453 GCTCGCGCGGCGCCTGCGGGGGG + Exonic
1117882709 14:60327944-60327966 CGGAGGGCGCCGCCTGCGGGAGG + Intergenic
1122077727 14:99246527-99246549 GCGGGGGCCTCCCCTGCGAGCGG - Intronic
1122162287 14:99793271-99793293 GCGCCCGCTCCGCCCGCGAGGGG - Intronic
1122327574 14:100891633-100891655 GGGCGTGTGCCGCCTGCGGGAGG + Intergenic
1122464841 14:101925011-101925033 GCCAGGGTGCCGCCAGCGAGTGG + Intronic
1124212065 15:27771343-27771365 GGACGGGCCCTGCCTGCGAGAGG + Intronic
1126436695 15:48645037-48645059 ACCCGTGCGCCGCCTGCGCGTGG + Intronic
1128067880 15:64775644-64775666 GGGCGGGCGCCGGCGGCGGGGGG + Intergenic
1129051200 15:72783460-72783482 GCGCTGGCGCCGCGTGGCAGTGG - Exonic
1129423836 15:75451165-75451187 GCGCCGGCCCCGCCTCTGAGCGG + Intronic
1129503209 15:76059802-76059824 GCGCGCGCGCGGCCGGCGGGAGG + Intergenic
1130002584 15:80059973-80059995 CCGCGGGGGCCGCGGGCGAGAGG + Intronic
1131635802 15:94231711-94231733 GCACGGTCGCCGCCTGGGGGTGG + Intronic
1132111520 15:99105328-99105350 GCGCGGCCGGCGCGGGCGAGAGG + Exonic
1132398267 15:101489642-101489664 CCGCGCGCGCCGCCTGCGCCCGG - Exonic
1132588141 16:715111-715133 GCGCCGGGGCCGCCTTGGAGCGG - Exonic
1132609408 16:807732-807754 GGGCGGGCGAAGGCTGCGAGCGG - Intronic
1132663775 16:1072739-1072761 TCCCGGGCGCCGGCTGGGAGGGG - Intergenic
1132665427 16:1079312-1079334 CCGCTGGCGCCGCCCGCGTGTGG + Exonic
1141132262 16:81444654-81444676 CCGCGGACTCCGCCCGCGAGAGG + Intergenic
1141430466 16:83968370-83968392 GCGCGGGCGCAGCCACAGAGGGG - Intergenic
1141553179 16:84819802-84819824 GCGCGGGCGCCGGGTGGGCGAGG - Intergenic
1141608764 16:85169916-85169938 GCGCCGGGGCCCCCCGCGAGTGG + Intergenic
1141841976 16:86579275-86579297 CCGCGGGCGCTGCCTGCAGGCGG - Exonic
1142762341 17:2050012-2050034 GCGCGGACGGCGCCGGCGCGGGG + Intergenic
1142876307 17:2853682-2853704 GCGCGGGCGGCGCGTCTGAGCGG + Intronic
1144692890 17:17280627-17280649 GAGCGTGCGCCGCCTGGCAGCGG + Intronic
1146283226 17:31558826-31558848 GCGGGGGCGCGGCCCGGGAGCGG + Intergenic
1146794272 17:35770148-35770170 GCGCGCGCGGCGCGGGCGAGTGG + Exonic
1147740424 17:42668178-42668200 GCCCGGGCGCTGGCTGGGAGGGG + Exonic
1148775844 17:50095383-50095405 GCGCGAGCGCTGCCCGCGCGGGG + Exonic
1150168492 17:62966656-62966678 TCGCGGGCGGCGCCGGCGGGCGG + Intergenic
1151314262 17:73312041-73312063 GCGCGGGCGGAGCCTGGAAGGGG - Exonic
1152362730 17:79839917-79839939 GCGCGGGCCCCGCCGGCAGGGGG + Intergenic
1152628851 17:81400579-81400601 GCGCGGGCGCGGGCTGGGGGTGG + Intronic
1152814275 17:82398166-82398188 GCGCGGGCGGGGCCTGGGCGTGG - Intronic
1153911267 18:9708299-9708321 CCGCGGGCGGCGCGAGCGAGGGG + Exonic
1155257795 18:24014205-24014227 TCGCGGGCGCGGGCTGCGTGGGG + Intronic
1160507795 18:79437057-79437079 GCCCTGGAGCCGTCTGCGAGGGG + Intronic
1160909799 19:1469196-1469218 GCGCGGGGGCCGCCTGGGCCTGG + Exonic
1161031894 19:2061442-2061464 GCGCGGCCGCCGCCGGGGAGGGG - Intergenic
1161064764 19:2232168-2232190 GGGCGGGCGGCGCCTGGGAGTGG + Exonic
1161212740 19:3076091-3076113 GCACGGGCGCCGCGTGGGTGGGG - Intergenic
1161388108 19:4007678-4007700 GCGGCGGCCCCGCCCGCGAGTGG + Exonic
1162951338 19:14073528-14073550 GCGCCAGCGCCGCCTGCCGGTGG - Exonic
1164713303 19:30374793-30374815 GCCCGGGCGCCGGCTGGGGGTGG - Intronic
1166631176 19:44409422-44409444 GGGCGGGCGCAGCCTGGCAGCGG - Intergenic
1166632054 19:44415549-44415571 GGGCGGGCGCAGCCTGGCAGCGG - Intergenic
1166636997 19:44459159-44459181 GGGCGGGCGCAGCCTGGCAGCGG + Intergenic
1166888257 19:45973957-45973979 GCGCGGGCGGCGGCGGCGACGGG + Intergenic
1166984144 19:46649579-46649601 GCGCAGGCGCCGCCGCCGGGGGG - Exonic
1168718964 19:58544540-58544562 GCGCGGGCGGCGCCTTCGGGAGG + Exonic
925730706 2:6917886-6917908 GCGCGGGCGCCGCCTGCGAGAGG - Intronic
926685410 2:15694204-15694226 GCCCGGGCGCGGCCTGAGACTGG - Intronic
927904526 2:26847664-26847686 GCGCGGCCGCAGCCCGGGAGAGG + Intergenic
927965350 2:27264517-27264539 GTGCGGGCGGCGCGTGCGAAGGG + Intronic
929075720 2:38077221-38077243 GCCCGGGCTCGGCCTGCGGGTGG - Intronic
930593426 2:53356711-53356733 GCGTGGGAGCCCACTGCGAGGGG - Intergenic
931355982 2:61538016-61538038 GCGCCGGAGCCGCGTGAGAGAGG - Exonic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
934177135 2:89585597-89585619 GCGCGGGCGCAGGCGCCGAGAGG - Intergenic
934287442 2:91659956-91659978 GCGCGGGCGCAGGCGCCGAGAGG - Intergenic
937160825 2:119759745-119759767 GCGCAGGCGCCGCCAGTCAGTGG - Exonic
939178712 2:138780572-138780594 GCGCGTGGGGCGCCTGCGGGAGG + Intergenic
942023909 2:171894307-171894329 ACGCGCGCGGCGCCGGCGAGAGG - Intronic
942505605 2:176638246-176638268 GCGAGGGCGCGGCGTGCGCGCGG + Intergenic
944495800 2:200306637-200306659 GGGCGGGGGCAGCCTGCGAGGGG + Intronic
944579043 2:201116502-201116524 GCTCCGGCGCCGCCAGCGCGGGG - Intronic
946418461 2:219552139-219552161 GGGCGGGCCCCGCCTGGAAGCGG + Exonic
1168883453 20:1226222-1226244 GCGCCGGCGCCGGGTGCGTGTGG - Intronic
1169065683 20:2693163-2693185 GCGCTGGCGCCGCGGGCGGGCGG + Intronic
1169074340 20:2752029-2752051 CCGCGGGCGCCGCGTGCTGGGGG - Intronic
1170026059 20:11890959-11890981 GTGAGGGCGCCGCGGGCGAGCGG + Intronic
1170578677 20:17682198-17682220 GCGCGCACGCAGCCAGCGAGCGG - Exonic
1170968935 20:21101295-21101317 GCGCGGGGGCCGACATCGAGAGG + Intergenic
1172539361 20:35699193-35699215 GCGCAGGCGCAGCCCCCGAGTGG + Exonic
1176084075 20:63288021-63288043 GGGTGTGCGCCGCCTGCGCGTGG + Exonic
1176125276 20:63472273-63472295 GCGCCCGCGCCGCCCGCGCGAGG + Exonic
1176555781 21:8253470-8253492 GCGCGGCCGGCGCCCGCGGGCGG - Intergenic
1176574718 21:8436504-8436526 GCGCGGCCGGCGCCCGCGGGCGG - Intergenic
1176611332 21:8987797-8987819 GCGCGGCCGGCGCCCGCGGGCGG - Intergenic
1176722827 21:10405606-10405628 GCCGGCGCGCCGCCTGGGAGCGG - Intergenic
1180061143 21:45385668-45385690 GGGAGGGCCCTGCCTGCGAGCGG - Intergenic
1180303991 22:11058348-11058370 GCCGGCGCGCCGCCTGGGAGCGG - Intergenic
1180614771 22:17120231-17120253 GCGGGGGCGCCGGCGGCGCGGGG - Exonic
1185258437 22:49849121-49849143 GGGCGGGCGCCGCGGGCGAGGGG - Intergenic
1185276303 22:49951484-49951506 GGGCGGGGGCCACCTGCGCGAGG + Intergenic
1185289277 22:50015672-50015694 GCGCGGGCGTCGCCTGTTGGTGG - Intronic
1185317670 22:50185989-50186011 GCGCGGACGGCGCGTGCGTGAGG + Exonic
1185333350 22:50261332-50261354 GGGCGGGCGGGGCCTGCGCGGGG - Intronic
1203252766 22_KI270733v1_random:125555-125577 GCGCGGCCGGCGCCCGCGGGCGG - Intergenic
1203260822 22_KI270733v1_random:170641-170663 GCGCGGCCGGCGCCCGCGGGCGG - Intergenic
950345319 3:12287838-12287860 GCGCGGGCGCCGGCTGGGGGTGG - Intronic
956487706 3:69739840-69739862 GCGCGGCCCCCAACTGCGAGGGG - Intronic
960684761 3:120285284-120285306 ACGCGGGCGGCGCCAGGGAGGGG - Intergenic
961012921 3:123448142-123448164 ACCCGGGCGCCCCCTGCGGGCGG - Exonic
961300115 3:125916677-125916699 GCGCGCGCGCCGCCAGAAAGCGG - Intergenic
961585039 3:127915391-127915413 GCGCTGGCAGCGCCTCCGAGGGG - Exonic
961858277 3:129893762-129893784 GCGCGTGCGCCGCCGGCCGGGGG - Intergenic
963798709 3:149657030-149657052 ACGCGGGCGACGAGTGCGAGCGG + Exonic
966411850 3:179653143-179653165 GCGGCGGCGGCGCCAGCGAGCGG - Exonic
968574457 4:1358633-1358655 GCGCGGCCGCTGCGTCCGAGTGG + Intronic
971351860 4:25862757-25862779 GCCCGGGGGCCGACCGCGAGCGG + Exonic
974036372 4:56821709-56821731 GCACGAGCGCTCCCTGCGAGTGG - Exonic
986858886 5:11904008-11904030 GGGCGAGCGCCGCGGGCGAGAGG + Exonic
987050489 5:14143808-14143830 GCGGGGGCGGTGCCGGCGAGGGG + Exonic
987258164 5:16179180-16179202 GCGCGGGCGGCGAGCGCGAGCGG - Exonic
990210792 5:53480246-53480268 GCGCCGGCGCTGCCGGCGAGCGG + Intergenic
992444016 5:76818868-76818890 CTGCGGGAGCCGCCTGCGGGCGG - Intergenic
993901771 5:93588662-93588684 GCGCGGGTGCGGCCGGCGGGCGG + Intronic
995512228 5:112921479-112921501 GCGCCGGGGCCCCCTGCGGGAGG - Intronic
1001556559 5:172641227-172641249 GCGGCGGCGGCGCCTGCGGGAGG - Intergenic
1002559479 5:180071794-180071816 GCGCGCGCGCGGCCTGCGCGGGG + Exonic
1002722767 5:181273523-181273545 GCCGGCGCGCCGCCTGGGAGCGG - Intergenic
1003062834 6:2876099-2876121 GCGCGGGCGCGGGGTGCGCGTGG + Intergenic
1005288992 6:24359993-24360015 GCTCGGGCGCCGGCCGCGCGGGG + Intergenic
1006320147 6:33315203-33315225 GCGCCGGCACCGCCTGGGCGGGG - Exonic
1007533576 6:42564429-42564451 CCACAGGCGCGGCCTGCGAGGGG - Intronic
1013836599 6:114342412-114342434 CCGCCGCCGCCGCCTGCGTGTGG - Exonic
1015625916 6:135181133-135181155 GCGCGAGCGCCGAATGGGAGCGG + Intergenic
1016010653 6:139135148-139135170 GCGCGGGCGCCGCGGGCCCGGGG - Exonic
1019536301 7:1531271-1531293 GGGCGGGCGCCACGTGCGGGCGG + Intronic
1019828198 7:3301164-3301186 GCGCGGGCGGCGCGTGCGGCCGG + Intergenic
1022379136 7:29843452-29843474 GCTCAGACACCGCCTGCGAGCGG - Intronic
1022400056 7:30028417-30028439 GCCGTGGCGCCGCCTGCGACCGG + Exonic
1035683535 8:1507235-1507257 GCGCGGGAGCCCACCGCGAGGGG + Intronic
1037273725 8:17156495-17156517 GCGGAGGCGGCGGCTGCGAGCGG - Exonic
1037390514 8:18387245-18387267 GCGGCGGCGCCGCCAGCGGGAGG - Intergenic
1040065597 8:43141299-43141321 CCGCCGCCGCCGCCTGGGAGGGG + Intronic
1044719713 8:95133827-95133849 GCGGGGGAGTCACCTGCGAGCGG + Exonic
1045583117 8:103500435-103500457 GCGCGCGCGCCGCCTCGGAGGGG - Intergenic
1045583315 8:103501159-103501181 GCCTGGGCGCCGCCAGCGGGAGG - Intronic
1048553985 8:135457633-135457655 GCGCGGGGGCCGCCGGCGCTGGG + Exonic
1049552556 8:143267292-143267314 GCGCGGGCGCAGCCCACGAGGGG + Intronic
1049719606 8:144109612-144109634 ACGCGGGCGCCACCTGCACGTGG - Exonic
1049721082 8:144115872-144115894 GCGCCGGCGGGGCCTGCGTGGGG + Intronic
1057054532 9:91950291-91950313 GCGCCGGCGCCCCCTGCCGGGGG + Intergenic
1057147063 9:92765262-92765284 GCGTGGCCGCCGGCTGCCAGAGG - Intergenic
1059305380 9:113349695-113349717 CCGTGTGCGCCGCCTGCGCGGGG + Exonic
1061166063 9:128922669-128922691 GAGGGGGCGGGGCCTGCGAGGGG + Intronic
1062436000 9:136546791-136546813 GCCCGGGCGCCGCCTGCCTAAGG + Intergenic
1062540947 9:137041338-137041360 GCGCGGGCGCTTCCTGTGAGGGG + Intronic
1203469169 Un_GL000220v1:108706-108728 GCGCGGCCGGCGCCCGCGGGCGG - Intergenic
1203476990 Un_GL000220v1:152678-152700 GCGCGGCCGGCGCCCGCGGGCGG - Intergenic
1189005097 X:36986341-36986363 GCGAGGGCGCGGCCTCAGAGGGG - Intergenic
1189043923 X:37571601-37571623 GCGAGGGCGCGGCCTCTGAGGGG + Intronic
1200092567 X:153642723-153642745 GCGCGTGCGCCGGCTTCGTGGGG - Intronic
1200235238 X:154464872-154464894 AGGCGGGCGCCGCATGTGAGGGG + Intronic