ID: 925733218

View in Genome Browser
Species Human (GRCh38)
Location 2:6937736-6937758
Sequence CACGGCCAGGTGATGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925733218 Original CRISPR CACGGCCAGGTGATGTTTGG AGG Intronic
900105651 1:979794-979816 CACATCCAGGCCATGTTTGGAGG + Exonic
901789571 1:11647251-11647273 CCAGGCCAGGTCATGTGTGGGGG - Intergenic
902263294 1:15243460-15243482 CGCGGCCAGGAGAGGTGTGGAGG - Intergenic
903058246 1:20651762-20651784 CGGGGCCAGGTGAAGTTTGAGGG + Exonic
903323693 1:22557128-22557150 CAAGGGCAGGTGGTGTTTGAAGG + Intergenic
903846234 1:26281170-26281192 CATGGCCAGGTGAAGGCTGGGGG - Exonic
904165162 1:28549686-28549708 CACGGACAGGGGATGGTTTGGGG + Intergenic
911373486 1:97023455-97023477 CACTGCCAGGGGATGTGGGGAGG - Intergenic
911505017 1:98738000-98738022 CAAGGCCAGGTGCTAATTGGTGG + Intronic
915795768 1:158731974-158731996 CACAGCAAGCTGATGTGTGGCGG + Intergenic
916850788 1:168701256-168701278 CACAGCCTGGAGTTGTTTGGTGG - Intronic
917294130 1:173501665-173501687 CACGCCCAGCTAATTTTTGGTGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919824745 1:201495499-201495521 CTGGGCCAGGTGATGTTTCCAGG - Intronic
923515972 1:234698376-234698398 CAAAGCCAGGTGATGTTTCTGGG - Intergenic
924640802 1:245831760-245831782 CACGGCCAAGTCAGGTTTTGTGG + Intronic
1065877039 10:30006505-30006527 CCTGGCCAGGTGAGGTTAGGCGG - Intergenic
1067306635 10:45070826-45070848 CAGGGCCAGGGGACTTTTGGGGG + Intergenic
1067546455 10:47195799-47195821 CACGTCCAGGGCAGGTTTGGGGG - Intergenic
1070978089 10:80621797-80621819 TAGGGCCAGGTCATGTTTAGGGG - Intronic
1075809870 10:125217387-125217409 CACAGCCAGGTGAGTTTGGGTGG - Intergenic
1076433197 10:130422013-130422035 CACAGTCCGGTGATGTTTTGCGG - Intergenic
1076703080 10:132284273-132284295 CAGGGGCAGGTGAGGTTGGGGGG + Intronic
1076703134 10:132284402-132284424 CAGGGGCAGGTGAGGTTGGGGGG + Intronic
1077248386 11:1549930-1549952 GAAGGCCAGGTTGTGTTTGGAGG - Intergenic
1083710422 11:64545057-64545079 CAATGCCAAGTGGTGTTTGGTGG + Intergenic
1085054929 11:73397943-73397965 CAAGGCCAGGTGCTGCTGGGGGG + Intergenic
1088138545 11:106586762-106586784 CACTGCCAGGTAATTTTTGCAGG - Intergenic
1089769630 11:120793864-120793886 GAGAGCCAGGTGATGGTTGGAGG + Intronic
1089846919 11:121465944-121465966 CTAGGCCAGGTGATCTTTGGGGG + Intronic
1090499945 11:127251650-127251672 CACGGGCTGGTGAGTTTTGGAGG + Intergenic
1095500221 12:42829579-42829601 CTCTGCCAGGTAATTTTTGGGGG + Intergenic
1103392362 12:120583896-120583918 CCCGGCCAGGTGCTGTCAGGAGG + Intergenic
1103836375 12:123824330-123824352 CAGGGCAAGGTGATGTCTGCTGG + Intronic
1106757548 13:32838063-32838085 CAAGGCCAGGTGAGCTATGGAGG + Intergenic
1109878146 13:68432114-68432136 CAGGGCCAGTTGGTGTGTGGGGG + Intergenic
1112052156 13:95653680-95653702 CATGGCCTGGTGAGGTTTGGTGG - Intergenic
1119860731 14:77934098-77934120 GAAGGCCAGGGGCTGTTTGGTGG + Intronic
1121199407 14:92105257-92105279 CAGGGCCAGGTAATGTTTTTGGG - Intronic
1124372166 15:29110177-29110199 CAGGGCCTGGTGATGGTCGGGGG - Intronic
1126780117 15:52132610-52132632 CAGGGCATGGTGATGTGTGGAGG - Intronic
1126864202 15:52920012-52920034 CAGGGCCAGGGGAAGTTTGTGGG + Intergenic
1133128907 16:3664316-3664338 CTCTGCCAGGTGACGGTTGGGGG + Exonic
1136665791 16:31811222-31811244 CACGGCCAGGGAGTGTGTGGAGG + Intergenic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1141769729 16:86082544-86082566 GATGGACAGCTGATGTTTGGAGG + Intergenic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1144130032 17:12238024-12238046 CACGCCCAGCTAATTTTTGGGGG - Intergenic
1151088567 17:71409018-71409040 CACGCCCAGCTGATTTTCGGAGG - Intergenic
1152940837 17:83172325-83172347 CACAGCCAGGTGGTGTGTTGGGG - Intergenic
1156285468 18:35690378-35690400 CATGGTCAGGTTTTGTTTGGTGG + Intronic
1157551254 18:48583172-48583194 CATGGCCAGGTCATGTGTGGGGG - Intronic
1159028394 18:63207299-63207321 CACAGCCAGGTGCAGTTTTGTGG - Intronic
1161028809 19:2048662-2048684 CAAGGCCAGGAGATGGGTGGAGG + Intronic
1161417109 19:4153563-4153585 CACCTCCAGGTGCTGATTGGTGG - Intergenic
1161466505 19:4433531-4433553 GACGGCCAGGTGAGGTGGGGTGG + Exonic
1163393484 19:17044969-17044991 CCAGGCCAGGTGATGGTTAGAGG + Intergenic
1165178668 19:33948951-33948973 CACGACCAGGTCACATTTGGAGG + Intergenic
1168400825 19:56085391-56085413 CACGGCAAGGTGAGGCTAGGCGG - Intergenic
925733218 2:6937736-6937758 CACGGCCAGGTGATGTTTGGAGG + Intronic
933405333 2:81850923-81850945 CACAGACACCTGATGTTTGGAGG - Intergenic
937120803 2:119438956-119438978 CACGGGGAGGGGATGTATGGAGG + Intergenic
937279690 2:120709080-120709102 CAGGGCTAGGTGCTTTTTGGTGG + Intergenic
938063513 2:128269324-128269346 CAAGGCCTGGTGGTGGTTGGGGG + Intronic
942208588 2:173648203-173648225 CGTGGCCAGCTGATGTATGGAGG - Intergenic
946301263 2:218825489-218825511 CACGCCCAGCTAATTTTTGGGGG - Intronic
1175952223 20:62589529-62589551 CACTGCCAGCTGAAGTTTGAGGG + Intergenic
1179790294 21:43752427-43752449 CACTGCCAGGTGATGGATCGGGG + Intronic
1183141953 22:35950722-35950744 CTCGGCCAGGAAGTGTTTGGTGG + Intronic
1184865630 22:47200467-47200489 CAAGGCCAGGAAATGTGTGGAGG + Intergenic
1185053709 22:48567053-48567075 CACGGGCAGGTGCTGCTTCGGGG + Intronic
950327043 3:12120592-12120614 CATGGCCAGGTGTGGTTTTGGGG + Intronic
954261163 3:49439911-49439933 CACGGCCAGCTAATTTTTGACGG + Intergenic
954592187 3:51792407-51792429 GCCTGCCAGGTGATGTGTGGTGG + Intergenic
964546041 3:157834956-157834978 CAAGGCCTGGGGTTGTTTGGAGG - Intergenic
969624121 4:8293761-8293783 CACCGCCAAGCCATGTTTGGAGG - Intronic
969865790 4:10076275-10076297 CACAGCCAAGTCATGCTTGGTGG - Intronic
974489622 4:62548188-62548210 CACGGCCTTGTGTTGTTTGCTGG - Intergenic
980516515 4:133869157-133869179 CACGTCCAGCTAATGTTTTGGGG - Intergenic
986224378 5:5799634-5799656 CAAGGCCAGGTCAGGTTTGGGGG - Intergenic
996683785 5:126257469-126257491 CACCTGCATGTGATGTTTGGGGG + Intergenic
998051284 5:139038130-139038152 CCCTGCAATGTGATGTTTGGAGG - Intronic
1001999182 5:176187660-176187682 CACTGCCAGGTGATGTGGAGGGG - Intergenic
1010016753 6:71113504-71113526 CATGAACAGATGATGTTTGGAGG - Intergenic
1014770707 6:125454924-125454946 CAGGGCCAGTTGATGTTTTGGGG - Intergenic
1017182359 6:151565214-151565236 CAAGGCAGGGTGATGTCTGGTGG + Intronic
1017480029 6:154843951-154843973 CACTTCCATCTGATGTTTGGTGG - Intronic
1021402305 7:20223174-20223196 CAGAGGCAGGTGATGTTTTGGGG - Intergenic
1023906235 7:44523572-44523594 CATGCCCAGCTGATATTTGGTGG - Intronic
1026808072 7:73440225-73440247 CAGGGCCAGGAGAGGCTTGGAGG + Intergenic
1029929372 7:104354476-104354498 CACTGCCAGCAGATGTGTGGGGG - Intronic
1034954821 7:155327803-155327825 CAGGGCTAGGAGGTGTTTGGGGG - Intergenic
1036814946 8:11895080-11895102 CACTGCCAGGGGATGTTGAGGGG + Intergenic
1037023100 8:13998343-13998365 CAAGGGCAGGGGATGCTTGGGGG + Intergenic
1038709927 8:29933954-29933976 CCAGGACAGGTGGTGTTTGGGGG - Intergenic
1048977007 8:139678723-139678745 CCTGGCCAGGTGAGGTCTGGGGG - Intronic
1049798263 8:144506204-144506226 CACGGCCAGGTCAGGTGCGGAGG - Intronic
1060923064 9:127436262-127436284 CAGGGCCAGGAGGTGTTTGGGGG + Intronic
1185669315 X:1793057-1793079 CACGGCAGGGTGATGCTTTGGGG + Intergenic
1187735166 X:22295674-22295696 CACAGCCAGGAGCTTTTTGGGGG - Intergenic
1187987572 X:24831199-24831221 CAGGGCCAAGCGATGTTTGGGGG + Intronic
1190429493 X:50365563-50365585 CAGGGCCAGGGGCTGGTTGGGGG - Exonic
1197390411 X:125856335-125856357 CGAGGCCAGGTGAGGTGTGGTGG - Intergenic
1198225962 X:134646196-134646218 CAAGGCCAGGTGAAGGGTGGAGG + Intronic