ID: 925741533

View in Genome Browser
Species Human (GRCh38)
Location 2:7009300-7009322
Sequence CATCTTGTTCTGTAGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925741527_925741533 11 Left 925741527 2:7009266-7009288 CCTTCCAGCAAGGATGCCACCTG 0: 1
1: 0
2: 0
3: 19
4: 196
Right 925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 180
925741528_925741533 7 Left 925741528 2:7009270-7009292 CCAGCAAGGATGCCACCTGCAAA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 180
925741525_925741533 15 Left 925741525 2:7009262-7009284 CCACCCTTCCAGCAAGGATGCCA 0: 1
1: 0
2: 1
3: 22
4: 246
Right 925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 180
925741526_925741533 12 Left 925741526 2:7009265-7009287 CCCTTCCAGCAAGGATGCCACCT 0: 1
1: 0
2: 0
3: 12
4: 158
Right 925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 180
925741530_925741533 -5 Left 925741530 2:7009282-7009304 CCACCTGCAAAGCAGGATCATCT 0: 1
1: 0
2: 0
3: 13
4: 197
Right 925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 180
925741531_925741533 -8 Left 925741531 2:7009285-7009307 CCTGCAAAGCAGGATCATCTTGT 0: 1
1: 0
2: 1
3: 4
4: 116
Right 925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925741533 Original CRISPR CATCTTGTTCTGTAGCTGAA GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
903376735 1:22871121-22871143 CATCCTGTTTTATAGATGAAAGG + Intronic
905445088 1:38022514-38022536 CATCACATTCTGGAGCTGAAAGG - Intronic
907760558 1:57354695-57354717 TCTCTAGTTCTGTAGATGAAGGG + Intronic
909967507 1:81933400-81933422 AATCTTCTTCTGTAGAGGAAGGG + Intronic
911403853 1:97411052-97411074 AATCATGTTCTTTACCTGAATGG + Intronic
912015040 1:105023570-105023592 CATCCTTTTCTATAGCTTAAAGG - Intergenic
912233793 1:107825992-107826014 CATCTATTACTGTTGCTGAAGGG - Intronic
912614366 1:111083027-111083049 TATCTTGTTCTGTATCTCAAGGG + Intergenic
915051614 1:153080419-153080441 TAACTTGTTCTGTAGCCTAATGG - Intergenic
916295208 1:163211620-163211642 CATCTTATTCTATAGTTGAGTGG - Intronic
916888865 1:169097245-169097267 AATATTGTCCTGTAGGTGAAAGG + Intergenic
916996430 1:170306755-170306777 TATGTTTTTCTGTTGCTGAATGG - Intergenic
921948319 1:220904286-220904308 CATCTTCTGCTTTAGCTGATGGG - Intergenic
923958113 1:239045366-239045388 CGTCTAGTTATTTAGCTGAAGGG + Intergenic
924052513 1:240092667-240092689 CCTCTTGCTCCGTAGCCGAATGG - Exonic
924194942 1:241596797-241596819 CATCTGTTTCTGTAGTTGAAAGG - Intronic
1064908633 10:20375184-20375206 CATGTTGTTGTGTAGATCAATGG + Intergenic
1067452423 10:46390528-46390550 CATCGTGTTGTGTAAATGAATGG + Intronic
1067460371 10:46453784-46453806 CATCTGGTTTTGTAGCTGTTTGG - Intergenic
1067584809 10:47469227-47469249 CATCCTGTTGTGTAAATGAATGG - Intronic
1067626819 10:47930819-47930841 CATCTGGTTTTGTAGCTGTTTGG + Intergenic
1067857768 10:49811170-49811192 CATGTTCTTCAGTAGATGAATGG - Intergenic
1069260766 10:66392997-66393019 CATGTTCTTCAGTAGATGAATGG + Intronic
1070579297 10:77707645-77707667 ATTCTTTTTTTGTAGCTGAATGG - Intergenic
1071511183 10:86263491-86263513 CGGCTTGTTCTGCAGGTGAAAGG - Intronic
1071989264 10:91084408-91084430 CATTCTTTTTTGTAGCTGAATGG + Intergenic
1073032371 10:100536854-100536876 CAGCTAGTTCTGTAGCTTGAGGG + Intronic
1073817937 10:107228094-107228116 CCTCATCTTCTGTAGCTGAAGGG + Intergenic
1075566664 10:123509918-123509940 CTTTTTCTTCTGTATCTGAATGG + Intergenic
1078191443 11:9094824-9094846 CATCTTGTTCTGCTGCTCCAGGG - Intronic
1078862301 11:15260599-15260621 CATCTTGTTTTGTACCTTCAAGG - Intergenic
1080223859 11:29937643-29937665 CATCTTGTTGTGGTGCTGATTGG - Intergenic
1083322037 11:61853890-61853912 CATTTTGTTCCAAAGCTGAAAGG + Intronic
1083955152 11:65978785-65978807 CATCTTCTTCAGGAGCTGAGGGG - Exonic
1086231316 11:84573617-84573639 CATTTAGTTCTTTACCTGAATGG - Intronic
1086584199 11:88432856-88432878 CAACTTGCCCTGTAGCTGGATGG - Intergenic
1087590453 11:100181154-100181176 GATGTTGTTCAATAGCTGAATGG + Intronic
1089300218 11:117494138-117494160 CATCTCCTTCTGTTTCTGAAAGG - Intronic
1090542000 11:127716720-127716742 TATGTTTTTCTGTAGCTTAATGG + Intergenic
1090576298 11:128108170-128108192 AATTTTGTTCTGTTGCTGAGAGG - Intergenic
1091184895 11:133638293-133638315 CATCTGCTGCTGTATCTGAAAGG + Intergenic
1093606231 12:21092429-21092451 CATCTTTTTTTGTGGCCGAATGG + Intronic
1094648748 12:32353512-32353534 CATCTTCTTCTGTAAATCAATGG - Intronic
1094797792 12:33996392-33996414 TATTTTGTTTAGTAGCTGAAGGG - Intergenic
1095302529 12:40601997-40602019 CATCTTGGTCTTTAGCTTATTGG + Intergenic
1099049382 12:77764900-77764922 CATCTGGGTATGTAGCTGCATGG + Intergenic
1099480890 12:83165039-83165061 ACTTTTCTTCTGTAGCTGAAAGG + Intergenic
1101283443 12:103283869-103283891 TTTCTTGTTCTGTACCTGAAAGG - Intronic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1101971299 12:109314774-109314796 CTCCTTGTTCTGTAGCTACATGG + Intergenic
1103735042 12:123055703-123055725 GATCTGGTTTTGAAGCTGAATGG - Intronic
1106034183 13:26028877-26028899 CATCTTGCCCTGTAGCTGGGAGG + Intergenic
1106199625 13:27525578-27525600 CATCCTGCTCTGTGGCTGACAGG + Intergenic
1107260053 13:38479578-38479600 CTTCTTGTACTGTAGCTTAGCGG + Intergenic
1108135204 13:47349429-47349451 CATCATTTTCTGTAACAGAAGGG - Intergenic
1109732277 13:66429692-66429714 CTTCTTCTTCTTTAGCTGCAGGG - Intronic
1110188289 13:72700822-72700844 CATCTTGTTCGGTGGCTTAAAGG + Intergenic
1110896924 13:80764864-80764886 CATTTTGTTCTGTAGTTACAGGG + Intergenic
1111238914 13:85449217-85449239 TATCTTTTTCTGAAGATGAATGG + Intergenic
1111295619 13:86274717-86274739 CATCCTTTTTTGTAGCTGTATGG - Intergenic
1113660128 13:112101680-112101702 CATAATCTTCTGTAGCAGAATGG - Intergenic
1114530492 14:23392574-23392596 CAGTTTCTTCTGTAGTTGAAGGG + Exonic
1115009932 14:28533687-28533709 CATCTTGTTCTGGTCCTCAAGGG + Intergenic
1117228626 14:53691544-53691566 CATCTGGTTTTTTTGCTGAATGG - Intergenic
1117442178 14:55770343-55770365 CATGCTGTGCTGGAGCTGAAAGG + Intergenic
1118599203 14:67459607-67459629 CAGCTTGATTTGAAGCTGAAAGG + Intronic
1120413184 14:84184291-84184313 GATCTTGTTCTTTGGCTGAAGGG + Intergenic
1121317150 14:92969130-92969152 CATGTTTTTCTGTTGGTGAATGG - Intronic
1122180643 14:99951879-99951901 CATCATGTTATGCAGCTGATAGG - Intergenic
1124888435 15:33709395-33709417 CAGCATGTACAGTAGCTGAAAGG + Intronic
1125063307 15:35451384-35451406 CATTTTGTACTCTAGCTGCATGG + Intronic
1125755794 15:42063847-42063869 GATCTTGTTCCTTAGCTGTAAGG + Intergenic
1126305747 15:47254496-47254518 CATCTTGTTCTAGATCTAAAGGG + Intronic
1126874767 15:53029406-53029428 CATCAGGTTCTGTATCTGACTGG - Intergenic
1127534329 15:59875723-59875745 CATCATTTTCTATAGCTGCATGG - Intergenic
1131548960 15:93339899-93339921 CAGCTTGCTATGTAGCTGACGGG + Intergenic
1131763434 15:95649788-95649810 CATTTGGGTCTGTGGCTGAATGG - Intergenic
1131893733 15:97003364-97003386 CTTCTTGTTCTATTGATGAAGGG + Intergenic
1136393731 16:29981646-29981668 CACCTTTTTCTGTAGCTGAACGG + Exonic
1141092971 16:81142988-81143010 AAGCTTGTCCTGTAGGTGAAGGG - Intergenic
1141451836 16:84108905-84108927 CATTTTGTTCTGATACTGAATGG - Intronic
1142940642 17:3377715-3377737 CATCTTTTTCTTTATCTGTATGG - Intergenic
1143959985 17:10708733-10708755 CAGCCTGTTCTGGAGCTGAAAGG + Intronic
1145086618 17:19947491-19947513 CATCTTGTTCTATACCTGCAAGG + Exonic
1148137613 17:45304762-45304784 CATCCTGTCATGTAGCTGAATGG - Intronic
1148802330 17:50237864-50237886 GATGTTTTTCTGTAGGTGAATGG - Intergenic
1149628778 17:58102004-58102026 CATCTTTTTCTATAGCAAAAAGG + Intergenic
1149711921 17:58751127-58751149 GATGTTGTTCTGGAGCTGAGGGG + Intergenic
1156119500 18:33824683-33824705 CATCTTGTTTGACAGCTGAATGG - Intergenic
1156377413 18:36527411-36527433 CATCCTGTCATCTAGCTGAATGG + Intronic
1158376863 18:56881032-56881054 CATCTTTTTCTCTTGCTTAAAGG - Intronic
1159063806 18:63545712-63545734 CATCCTGTTCTGAATATGAATGG + Intergenic
1159081020 18:63736201-63736223 CATCCTTTTTTATAGCTGAATGG - Intergenic
925206691 2:2013327-2013349 GATCTTGGCCTGGAGCTGAAGGG - Intronic
925409907 2:3633995-3634017 CACCGTGGTCTGAAGCTGAAAGG - Intronic
925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG + Intronic
925989390 2:9241811-9241833 CATTTTGATCTGGACCTGAAAGG + Intronic
926836559 2:17030271-17030293 CAACCTGTTCTGTAGCTGTCAGG + Intergenic
935593575 2:104862896-104862918 CATTTTGATCTGTAATTGAAAGG - Intergenic
939752175 2:146061982-146062004 AATCTTTTTCTATAGATGAATGG - Intergenic
946973394 2:225120603-225120625 CATCTGCTTCTGCATCTGAACGG + Intergenic
948672745 2:239578972-239578994 CAACTTGTTCTGAACCTGCATGG + Intronic
1171073373 20:22097824-22097846 CAACCTGCTCTGCAGCTGAAAGG - Intergenic
1181495089 22:23283204-23283226 CATCTTGGTCTGCATCTGAAAGG - Intronic
1182894774 22:33850037-33850059 GATCTGGTTCTGTAGCTTGAGGG + Intronic
1184540650 22:45122001-45122023 CATCGTGTCATTTAGCTGAAAGG - Intergenic
949828329 3:8186137-8186159 CACCTTGTTCTGCAGGTGGATGG + Intergenic
950614061 3:14145661-14145683 CAAAGTGTTCTGTAGCTCAAAGG + Exonic
950795390 3:15506287-15506309 CATCTTGTGCTCCAGATGAAAGG + Intronic
950817284 3:15719167-15719189 CATTTTGTCCTGTAGTTGAGAGG + Intronic
951649263 3:24931399-24931421 CATCTTGTACCCTAGCTAAAGGG - Intergenic
954231589 3:49221931-49221953 CATCTTGTACTATCGCTGACTGG + Intronic
955839575 3:63097454-63097476 CATCTTGTTCTGCTGCTCTAGGG + Intergenic
956327142 3:68066487-68066509 CATCTTTTTCTCTATCTGAATGG + Intronic
960546923 3:118926176-118926198 CATCCTGCTCTGTAGCTCAGAGG - Exonic
960842750 3:121977101-121977123 CTTCTTCTTCTGTAGATCAATGG - Intergenic
961728043 3:128945652-128945674 CATCTTGTTCTGGGACTCAAAGG + Exonic
964381759 3:156104651-156104673 CATCTTTTTGTGTTGGTGAATGG - Intronic
965748545 3:171951730-171951752 CATCTTGTTCTTTGGATCAATGG + Intergenic
969896613 4:10311211-10311233 GATCTTGTTCTCTAACTGGAAGG + Intergenic
975722915 4:77265608-77265630 CATCATGTTGTCTAGCTGCAAGG + Intronic
976777551 4:88722593-88722615 GATCTTGTGCTGTAGCTCCAGGG - Intergenic
976826188 4:89263245-89263267 CATCTTATTTTGTAGGTGAATGG - Intronic
977472866 4:97464003-97464025 GATGTTGTTCAGTAGGTGAATGG - Intronic
978764646 4:112391655-112391677 CTTCTTGATCTGCAGCTGTATGG - Intronic
980620889 4:135302114-135302136 CATCCTGTTCTATGACTGAAAGG - Intergenic
982605263 4:157507916-157507938 CATCATGGTCAGCAGCTGAAAGG + Intergenic
983562830 4:169118094-169118116 TAGCTTGTTCTGTAGATGAAGGG - Intronic
984312818 4:178084974-178084996 CAGCTGGTTATGAAGCTGAAAGG + Intergenic
986743406 5:10723878-10723900 CATCTTGCTCTGTATCTTAGGGG + Intronic
987375721 5:17232207-17232229 CATCGTGTTGTGTTTCTGAAAGG - Intronic
987425941 5:17772648-17772670 CATCTTGGTCTTTGGCTGGAGGG + Intergenic
989204389 5:38796988-38797010 CTTCTGGTTCTGCAGCTAAATGG + Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
993422640 5:87721067-87721089 CAACTGGTTCTGTAGCTGTATGG - Intergenic
995136692 5:108686529-108686551 CATCTTGTTTTATAGCAGAGTGG + Intergenic
995907542 5:117143489-117143511 AATCTTACTCTGTAGCTTAAGGG - Intergenic
998101982 5:139442091-139442113 CATCTTCTTCTGTTTCTGAAAGG - Intronic
1000486161 5:161847501-161847523 CACCTTCTTCTGTAGCTTAGAGG - Intronic
1002648779 5:180676101-180676123 CATGTTCTTCAGTAGGTGAATGG - Intergenic
1003700692 6:8461570-8461592 CATCTTGTACAGTAGCTCACAGG + Intergenic
1003806059 6:9727150-9727172 CATCTTGTACTGTCCCTGACTGG - Intronic
1004444498 6:15685623-15685645 TATCTTGTTCTGTAGTTGTAGGG + Intergenic
1006242871 6:32701237-32701259 CAAATAGTTCTGTAGCTGGAGGG - Intergenic
1006970936 6:38043964-38043986 CATGTAATTCTGTAGATGAAGGG - Intronic
1007606378 6:43120967-43120989 CATCTTCTTCTGGGGCTGGAAGG - Intronic
1009627752 6:66158873-66158895 CATCTCATTCTGTGGCTGTAAGG - Intergenic
1009752898 6:67895394-67895416 CATGTTGTTAAGTAGATGAATGG - Intergenic
1010253976 6:73737221-73737243 CAACTTTTTCTGTATCTAAAGGG + Intronic
1013727480 6:113117143-113117165 CATCTTGTTCTGGTTCTCAAAGG - Intergenic
1016595860 6:145800268-145800290 CATTTTGTTCTGTTAATGAATGG - Exonic
1016782024 6:147969280-147969302 CATCTTGTTTTATGGCTGCATGG + Intergenic
1016804811 6:148202059-148202081 CATGTGGTCCTGGAGCTGAAGGG + Intergenic
1018338120 6:162817710-162817732 TATCTTAATCTGTAGCTGCATGG - Intronic
1018606531 6:165603440-165603462 CAACTCATTTTGTAGCTGAAAGG + Intronic
1023596889 7:41839036-41839058 CATATTCTTCAGTAGATGAATGG - Intergenic
1024337989 7:48228548-48228570 CAGCTTGGTCTGTACCTCAAGGG - Intronic
1027619015 7:80460077-80460099 GATGTCCTTCTGTAGCTGAAAGG + Intronic
1028137009 7:87232530-87232552 GATCATGCTCTGTAGCTGATCGG - Intergenic
1029541136 7:101182758-101182780 CCACTTGTTCTCTAGCTGAGAGG - Intergenic
1030270312 7:107662224-107662246 CATCCTGGTCTCTAACTGAATGG - Intronic
1031255796 7:119446766-119446788 CATCTTGTTATGGTTCTGAAGGG + Intergenic
1031581456 7:123479915-123479937 AATCTTTTACTGGAGCTGAAAGG - Exonic
1036012016 8:4736593-4736615 CATATTGTACTGGAGCTAAAAGG + Intronic
1037028730 8:14074048-14074070 CATCCTGTTTTGTGGCTGCATGG + Intergenic
1037375236 8:18220136-18220158 CATCTTGTTCTCTCTCTGAGTGG + Intronic
1037793842 8:21974328-21974350 CATGTTGTACTGTGGCTTAATGG - Intronic
1037873400 8:22521434-22521456 ATTCTGGGTCTGTAGCTGAAAGG + Intronic
1038660519 8:29492872-29492894 CATCTTGCTCTGGAGGGGAAAGG + Intergenic
1040375980 8:46825000-46825022 CATCTGGGTGTGTAGCTGAGAGG - Intergenic
1043792091 8:84483346-84483368 CATCTTCTTCTGGAGGTGTAGGG + Intronic
1045898649 8:107247811-107247833 CATCTTTTTCTGGAGGAGAATGG + Intergenic
1045929952 8:107610343-107610365 CATCTTATTCTCTAGGTGAAGGG + Intergenic
1047099792 8:121664391-121664413 CATAGTGTTCTGGAACTGAAAGG + Intergenic
1047936610 8:129786681-129786703 CAGCTAGTTCTGTATGTGAAAGG - Exonic
1050704629 9:8383208-8383230 CATTTTGTTCTATGGCTAAAAGG - Intronic
1052023440 9:23549987-23550009 AATCTTACTCTGTGGCTGAAGGG + Intergenic
1052666427 9:31500514-31500536 CATTTTGTTTTATGGCTGAATGG - Intergenic
1054732694 9:68716923-68716945 AATCATGTTCTGTAGCATAATGG + Intronic
1054949496 9:70834372-70834394 CAGTAGGTTCTGTAGCTGAATGG - Intronic
1055185723 9:73451220-73451242 CATCTTGTGATGCGGCTGAATGG + Intergenic
1055760244 9:79599301-79599323 CATCCTGTGCTCTAGCTTAATGG + Intronic
1056556582 9:87694792-87694814 CATCCTGCTCTGTAGCCCAATGG - Intronic
1056911312 9:90703437-90703459 AAAGTTGTTCTGGAGCTGAATGG - Intergenic
1057144966 9:92752132-92752154 CTCCTTGTTCTGTTGCTGACAGG + Intronic
1185625567 X:1478990-1479012 CATCTGCTTCTGTGGCTGAGGGG - Intronic
1185843398 X:3414531-3414553 CATCTTGCTCTGTGGCCGCAGGG - Intergenic
1191633911 X:63355127-63355149 CCTATTGTTTTGTGGCTGAAGGG - Intergenic
1193223170 X:78951379-78951401 CATTTTCTTCAGTAGCAGAAAGG + Intronic
1194700155 X:97104270-97104292 CATCTTATTCTGTATCTATATGG + Intronic
1199249822 X:145647810-145647832 CTTTTTTTTCTGTTGCTGAAAGG + Intergenic
1200590623 Y:5070021-5070043 CATTTTGTACTGTTGATGAATGG - Intronic
1200739148 Y:6834161-6834183 CACCTTGTTGTAAAGCTGAAGGG - Intergenic
1201231603 Y:11870295-11870317 CATCTTGCTCTGTGGCCGCAAGG + Intergenic
1201797704 Y:17917703-17917725 TATTTTGTTCTGTAGCTACAAGG - Intergenic
1201803849 Y:17988254-17988276 TATTTTGTTCTGTAGCTACAAGG + Intergenic
1202359045 Y:24086442-24086464 TATTTTGTTCTGTAGCTACAAGG - Intergenic
1202511733 Y:25583672-25583694 TATTTTGTTCTGTAGCTACAAGG + Intergenic