ID: 925742167

View in Genome Browser
Species Human (GRCh38)
Location 2:7015469-7015491
Sequence CAGGCCTGATGCAGACCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 250}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925742153_925742167 27 Left 925742153 2:7015419-7015441 CCTTCATCGTGAGCCCTCCACTG 0: 1
1: 0
2: 0
3: 18
4: 426
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250
925742158_925742167 10 Left 925742158 2:7015436-7015458 CCACTGGGCCCTGAATAGTCCTT 0: 1
1: 0
2: 2
3: 15
4: 210
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250
925742162_925742167 1 Left 925742162 2:7015445-7015467 CCTGAATAGTCCTTCTGGCTGGA 0: 1
1: 0
2: 1
3: 11
4: 102
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250
925742160_925742167 2 Left 925742160 2:7015444-7015466 CCCTGAATAGTCCTTCTGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250
925742157_925742167 13 Left 925742157 2:7015433-7015455 CCTCCACTGGGCCCTGAATAGTC 0: 1
1: 0
2: 0
3: 5
4: 137
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250
925742164_925742167 -9 Left 925742164 2:7015455-7015477 CCTTCTGGCTGGAGCAGGCCTGA 0: 1
1: 1
2: 4
3: 40
4: 304
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250
925742156_925742167 14 Left 925742156 2:7015432-7015454 CCCTCCACTGGGCCCTGAATAGT 0: 1
1: 0
2: 2
3: 11
4: 117
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250
925742152_925742167 28 Left 925742152 2:7015418-7015440 CCCTTCATCGTGAGCCCTCCACT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG 0: 1
1: 1
2: 4
3: 24
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925742167 Original CRISPR CAGGCCTGATGCAGACCCAG GGG Intronic
900573750 1:3372911-3372933 AGGGCCTGATGCAGAGCCTGCGG + Intronic
902470256 1:16644167-16644189 CAGGCGTGGTGCAGACCCACAGG - Intergenic
902545914 1:17190327-17190349 CAGCCCTGATGGGGACTCAGGGG + Intergenic
902963099 1:19978505-19978527 CAGGCCTACTGCAGGCCCATGGG - Exonic
904010001 1:27383881-27383903 TAGGCCAGAGGCAGACACAGCGG - Intergenic
905557638 1:38899798-38899820 CAGGACTGGGGCAGACCCAGAGG - Intronic
905906659 1:41623035-41623057 GAGCCCGGATGCAAACCCAGTGG + Intronic
905924917 1:41742702-41742724 AAAGCCTTATGCTGACCCAGTGG - Intronic
907727335 1:57031990-57032012 CAGGCCTGATGGAGATACTGGGG - Intronic
910145592 1:84077566-84077588 CGGGGCAGATGCAGACCCAGAGG + Intergenic
910643631 1:89490276-89490298 CTGACCTGGTGCAGTCCCAGTGG + Intergenic
911417612 1:97595111-97595133 AAGGCCTGACGCAGGACCAGGGG - Exonic
917592986 1:176496520-176496542 CAGGCCTGTTGCTGAGCCACAGG - Intronic
918927816 1:190810127-190810149 CATGCCTGATGCAGTGGCAGTGG - Intergenic
920660829 1:207912750-207912772 GATGCCTGAAGCAGACCGAGCGG - Intergenic
921750231 1:218783653-218783675 CAGGGCTGAGGCAAACACAGTGG + Intergenic
922605758 1:226888932-226888954 TAGGCCTGCTGCAGCACCAGAGG - Exonic
924257971 1:242201469-242201491 TAGGTCTGATGGAGACTCAGAGG + Intronic
1062839508 10:658402-658424 CAGTCCAGTAGCAGACCCAGCGG - Intronic
1063295096 10:4797268-4797290 CAGCACTGCTGCAGGCCCAGGGG - Intronic
1063389520 10:5640245-5640267 CAGTCCTGGTGCCGACCCGGAGG + Exonic
1064938180 10:20703845-20703867 CAGTCCTGAAGTGGACCCAGGGG - Intergenic
1065404857 10:25352110-25352132 GAGGCCTTCTGCAGATCCAGAGG - Intronic
1065814579 10:29472662-29472684 CAAGCATGATGCAGGCCCTGGGG + Intronic
1067046583 10:42988665-42988687 CAGGCCAGATGCACAGCCACAGG - Intergenic
1070648047 10:78215080-78215102 CAGGCCTGGTGCAGAAGCACTGG + Intergenic
1070784533 10:79155338-79155360 CAGGTCTGATGCAAACTCAAAGG + Intronic
1074707700 10:116150155-116150177 CAGGAATGCAGCAGACCCAGAGG - Intronic
1075451290 10:122553400-122553422 CAGGGATGAAGCAGACCCAGCGG - Intergenic
1075921951 10:126220919-126220941 CAGGCCACATGGAGGCCCAGAGG + Intronic
1076783522 10:132737515-132737537 CAGACCTTGTGCAGACCCAGTGG + Intronic
1076879115 10:133231246-133231268 CCGCCCTGCTGCAGACCCTGGGG + Exonic
1078023588 11:7673955-7673977 CAGGGCTGACCCAGAGCCAGCGG - Exonic
1080555934 11:33417549-33417571 GAGGCCAGATGCAGAGACAGTGG - Intergenic
1080649904 11:34213588-34213610 CAGTTCTGACACAGACCCAGAGG + Intronic
1081593847 11:44445885-44445907 CAGGCTTGGGGCAGATCCAGGGG - Intergenic
1082705585 11:56490888-56490910 CTGGCCTGATGGAGACCATGTGG - Exonic
1082706651 11:56500788-56500810 CTGGCCTGATGGAGACCATGTGG - Intergenic
1083322716 11:61857238-61857260 CAGGCCTGATGGGGACACAGAGG + Intronic
1083367655 11:62151249-62151271 CGGGGCTGAGGAAGACCCAGGGG - Intronic
1084548246 11:69825245-69825267 CAGGTCTGAGTCAGAGCCAGAGG - Intergenic
1085535195 11:77213369-77213391 CAGCCCAGCTGCACACCCAGAGG + Intronic
1085634426 11:78147313-78147335 CAGACCTGATTCAGACCCATGGG - Intergenic
1085791804 11:79503028-79503050 CAGGCCAGCTGCACAGCCAGAGG - Intergenic
1085796333 11:79543294-79543316 CAGGCCTGAGTCAGGCACAGTGG + Intergenic
1088723929 11:112618188-112618210 CAGCCCAGGTGCAGACCCAGTGG + Intergenic
1090387471 11:126365241-126365263 CAGGGCTGGTGCACAACCAGAGG - Intronic
1090390037 11:126382439-126382461 CAGGGCTGGTGCACAACCAGAGG - Intronic
1090745542 11:129702071-129702093 CAGGCCTGATCCACAACCGGTGG - Intergenic
1090982124 11:131732365-131732387 GAGGCCTGATTCCCACCCAGTGG - Intronic
1092819393 12:12339170-12339192 CAGGCCTGATGGAGAGAAAGAGG + Intronic
1096194751 12:49642691-49642713 AGGGCCTGAGGCAGATCCAGAGG - Exonic
1097193448 12:57231331-57231353 CAGGCCTGGGGCAAAGCCAGAGG - Intronic
1097315925 12:58171497-58171519 CACTCCTGATGCAGGCCCAAAGG - Intergenic
1098873967 12:75847524-75847546 CTGACATGATGCAAACCCAGAGG + Intergenic
1101316741 12:103635705-103635727 CAGGCCTGAACCACACACAGAGG + Intronic
1102173778 12:110861356-110861378 CAGAGCTGATGCAGCCCCACTGG - Intronic
1102260018 12:111437893-111437915 CAGCCCTGGGGCAGGCCCAGAGG - Intronic
1102261875 12:111447882-111447904 GAGGCTTGCTGCAGACCCAGGGG + Intronic
1103016656 12:117499978-117500000 CAGGGTTGATTCAGCCCCAGTGG - Intronic
1103038272 12:117673915-117673937 CAGGGCTGATATAGCCCCAGAGG - Intronic
1103702898 12:122856842-122856864 CAGCCCTGACCCAGACCCAGGGG + Intronic
1103798409 12:123520921-123520943 CAGGGCTGCTGGAGACCCTGTGG - Intronic
1104611020 12:130227978-130228000 AAGGACTGAGGCAAACCCAGAGG - Intergenic
1104709270 12:130974003-130974025 GAGGCCTGATGCAGACGCAGAGG + Intronic
1105813735 13:24015551-24015573 CAGGCCTGACCCTGAGCCAGGGG + Intronic
1107315359 13:39125816-39125838 CAGGCCAGTTGGAGACACAGAGG + Intergenic
1113950570 13:114069276-114069298 CTGCCCGGCTGCAGACCCAGCGG + Intronic
1114775134 14:25473297-25473319 CAGCACTAATGCAGAACCAGAGG + Intergenic
1116317470 14:43416870-43416892 AAGACCTGATGGAGTCCCAGAGG - Intergenic
1116317699 14:43418147-43418169 AAGACCTGATGGAGTCCCAGAGG - Intergenic
1118615158 14:67569945-67569967 CAGGCCAGAGAAAGACCCAGGGG - Exonic
1118901151 14:69987006-69987028 CTGCCCTGAATCAGACCCAGAGG - Intronic
1119267151 14:73269731-73269753 CAGGCCTGATACAGACCTTGGGG + Intronic
1120871080 14:89338074-89338096 CTGGCCTCGTGCATACCCAGAGG + Intronic
1122309267 14:100784234-100784256 CAGGCCCCATCCAGGCCCAGGGG + Intergenic
1122725701 14:103750247-103750269 CAGGCCTGAAGCAGCTCCATGGG - Intronic
1124043442 15:26125959-26125981 CAGCCCTGATGCGGATCCGGAGG + Intergenic
1124606280 15:31172315-31172337 CAGTCCAGGTGCAGAGCCAGAGG - Intergenic
1125514194 15:40308794-40308816 CAGGCCTCAGGCAGTCCCAGAGG - Intergenic
1126860545 15:52878502-52878524 CCGGCAAGAGGCAGACCCAGAGG - Intergenic
1126954176 15:53914091-53914113 CAGGCCTGATACATACACATAGG - Intergenic
1127904831 15:63368794-63368816 AAGGCTTGATGCTGCCCCAGTGG + Intronic
1128127181 15:65201825-65201847 CAACCCTGTTGCAGACCCAGGGG + Intronic
1128386425 15:67152393-67152415 CAGGCCTGCTGCCGAGCGAGAGG + Intronic
1128754803 15:70174492-70174514 CAAGCCTGGAGCAGACGCAGAGG + Intergenic
1129455607 15:75674853-75674875 CAGGACTGATGGAGCCCCTGGGG - Exonic
1129606415 15:77027325-77027347 CAGGCCACATGCAGGCACAGTGG - Intronic
1129683056 15:77669145-77669167 CAGGCCTGCAGCAGAGGCAGAGG - Intronic
1130168448 15:81486608-81486630 CAAGCCTGATGCAAGTCCAGCGG + Intergenic
1130997007 15:88909528-88909550 CAGGCCTGATGCTGATGCAGAGG - Intronic
1132662066 16:1066044-1066066 CAGACCTGATGCGGAGCCCGAGG + Intergenic
1132703732 16:1232309-1232331 CAGCCCTGCAGCAGCCCCAGGGG - Intergenic
1132704778 16:1239052-1239074 CAGCCCTGCAGCAGCCCCAGGGG + Intergenic
1132707786 16:1254086-1254108 CAGCCCTGCAGCAGCCCCAGGGG + Intergenic
1132748823 16:1447978-1448000 CAGGGCAGATGCAGCCCCACTGG + Intronic
1132841676 16:1981120-1981142 CAGCCCTGGTGCAGATCAAGAGG - Exonic
1136234522 16:28905608-28905630 CTGGCCTGAGGGAGACACAGAGG + Intronic
1137604792 16:49780284-49780306 CAAGGCTGGTGCAGAGCCAGAGG + Intronic
1138193718 16:55036742-55036764 CAGGCCGGATGCAGGCTCTGAGG + Intergenic
1139004826 16:62558101-62558123 CTGACCTGGTGCAGACCCAGTGG - Intergenic
1140092712 16:71851005-71851027 CAGGCCTGAGTCAGTTCCAGTGG - Exonic
1140475770 16:75238621-75238643 CAGGCGTGCTGGAGACCTAGTGG - Intronic
1141090412 16:81126423-81126445 CAAGCAGGATGCAGACCCACTGG - Intergenic
1141518068 16:84559587-84559609 CAGCCCTGGGGCAGAGCCAGAGG + Intergenic
1141651161 16:85393911-85393933 CAGTCCTGATGCAGGCCCACTGG + Intergenic
1142040162 16:87888325-87888347 AAGGCCTGAGGGACACCCAGAGG - Intronic
1142138237 16:88461191-88461213 GAGGCCTGGTGAGGACCCAGGGG + Intronic
1142138248 16:88461217-88461239 GAGGCCTGGTGAGGACCCAGGGG + Intronic
1142380208 16:89727658-89727680 CAGACCTGAGGCAGCTCCAGAGG + Intronic
1143029496 17:3959963-3959985 CAGGCCTGATGCTGCTCCTGGGG + Intronic
1143584089 17:7842829-7842851 CAAGCCTGAATCAGACCCCGAGG + Intronic
1145772993 17:27506796-27506818 CAAGCCTGAGGAAGACCGAGGGG + Intronic
1145934004 17:28704517-28704539 TTGGCCTGAGGCAGGCCCAGCGG - Intronic
1147323441 17:39659259-39659281 CAGGCATGAGGCAGACCAGGGGG - Intronic
1151241005 17:72757830-72757852 CAGGCCTGGTCTAGATCCAGGGG - Intronic
1151540209 17:74760960-74760982 CAGGCCTGGTGCAGGGCCACTGG - Intronic
1151640646 17:75390409-75390431 CAGGCTTGAGACAGTCCCAGAGG - Intronic
1151766284 17:76135104-76135126 CAGGCCTGGTGCTCCCCCAGTGG + Intergenic
1152511916 17:80795751-80795773 CAGGACAGAGACAGACCCAGAGG - Intronic
1152893861 17:82898406-82898428 CAGCTCTGCTGCAGACCCTGGGG + Intronic
1154134033 18:11760654-11760676 CAGCCCCTATGAAGACCCAGGGG - Intronic
1154235052 18:12597325-12597347 CAGGCCTGAAGGAGAGCTAGAGG + Intronic
1157395271 18:47335978-47336000 CAGGCCTGAAGCACATCCAAAGG - Intergenic
1157550247 18:48576249-48576271 CAGGCCAGCTGCTGACCCAAGGG + Intronic
1161099918 19:2416451-2416473 CAGGGCTGATGCACACCCCCAGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1165933205 19:39373513-39373535 CAGGCCTGAGGCAGCAGCAGAGG + Intronic
1166053601 19:40275390-40275412 TAGCCTTGATGCAGACCCACTGG - Intronic
1166977383 19:46612666-46612688 CAGGCCAGAGCCAGAGCCAGTGG + Intergenic
1167984769 19:53305160-53305182 GAGGCCCGATCCAGACCCTGAGG - Intergenic
925527201 2:4815743-4815765 GTGGCCAAATGCAGACCCAGGGG + Intergenic
925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG + Intronic
927158046 2:20233198-20233220 CAGGCCAAATGCAGCCCTAGGGG - Intergenic
927504022 2:23601783-23601805 CTTGTCTGATGGAGACCCAGGGG + Intronic
927696618 2:25244000-25244022 CAGGTCAGATGCAGGCCCAGCGG + Intronic
927936201 2:27078299-27078321 GAGGCCTGCTCCAGCCCCAGGGG + Intergenic
928063068 2:28134568-28134590 CAGCCCTGAGGCAGACCAGGTGG + Intronic
929602148 2:43211049-43211071 GAGGCCTGGAGCAGTCCCAGTGG - Intergenic
929951173 2:46410636-46410658 CAGCCCTGATCCAGGCCCTGAGG + Intergenic
934735502 2:96687857-96687879 CAAGCCACATGCAGACCCGGAGG - Intergenic
937428400 2:121818171-121818193 CAAGCCAGCTGCAGCCCCAGAGG - Intergenic
937483595 2:122290339-122290361 CAGACCAGATGCATACCAAGAGG - Intergenic
938220817 2:129565862-129565884 CAGGGCTTATGCAGACTCTGAGG - Intergenic
940337370 2:152543424-152543446 CAGGACTGATTCAGGCCCACAGG - Intronic
941523139 2:166573870-166573892 CAGCCCTGATGCAGAGCCCATGG - Intergenic
942520083 2:176794609-176794631 CAAGCCACATGAAGACCCAGGGG - Intergenic
943112904 2:183628351-183628373 CACTCCTGATGCAGAACCACGGG - Intergenic
948756890 2:240165267-240165289 CAGCCCTGATGCAGAGTCTGTGG - Intergenic
1168840437 20:906688-906710 AGGGCCTGGTGCAGGCCCAGGGG - Intronic
1169214284 20:3784539-3784561 CGGGCCTGTTGCAGGACCAGGGG + Exonic
1169873735 20:10273925-10273947 AAGGCCTGTTGCAAACCCATGGG + Intronic
1171466021 20:25328514-25328536 GAGGCCTGAAGCGGAGCCAGTGG - Intronic
1172001170 20:31778424-31778446 CTGACCTGATGCATACCCAGAGG + Intronic
1172322656 20:34008604-34008626 CAGGCCAGATACAGCCCAAGGGG - Intronic
1172440274 20:34960572-34960594 CATGTGTGATGCAGACCCTGGGG - Intergenic
1172467423 20:35166510-35166532 CAGTGCTGGTGCAGCCCCAGTGG - Intergenic
1172617800 20:36300614-36300636 CAGGCCTGATGCCAGCCCCGGGG + Intergenic
1172993191 20:39050733-39050755 CAGGGCTCTTGCAGACCCAAGGG + Intergenic
1173053639 20:39589636-39589658 CAGGCCTGATGTATACCCTTGGG - Intergenic
1174067894 20:47878833-47878855 CGGGGCAGATGCAGCCCCAGGGG + Intergenic
1174079670 20:47962078-47962100 CAGGCCTGATGGAGTCACTGAGG + Intergenic
1175785074 20:61707170-61707192 CAGCCCTGCTGCTGAGCCAGTGG + Intronic
1180232694 21:46436825-46436847 CAGCCGTGAGGCAGAGCCAGGGG - Intronic
1181001183 22:19988483-19988505 CAGGGCTGACGCCCACCCAGTGG - Intronic
1181180660 22:21065922-21065944 CAGGGCTGAGGCAGCCACAGGGG - Intergenic
1182149691 22:28019376-28019398 CATGCCTGATGCCCACACAGAGG - Intronic
1182254610 22:29029473-29029495 TTGGACTGATGTAGACCCAGAGG - Intronic
1183045316 22:35214824-35214846 CAGGTCTGATGTAGAACCTGAGG + Intergenic
1184967927 22:47995254-47995276 CAGGCCTGCTGCACACGCACAGG - Intergenic
1185158904 22:49210826-49210848 CAGGCGTGAAGTAGACGCAGGGG + Intergenic
1185377026 22:50487408-50487430 CCGACCTGATGTGGACCCAGAGG + Exonic
949834641 3:8254652-8254674 CAGGCCATATGCAGGCCCAGGGG - Intergenic
949887219 3:8705708-8705730 AAGGCCTGGGGCAGTCCCAGAGG + Intronic
954293853 3:49663461-49663483 CTGGCGTGATGCTGCCCCAGAGG - Exonic
954793261 3:53148177-53148199 TAGGCCTGGTGCAGAACAAGAGG + Intergenic
954800418 3:53183872-53183894 CAGGCCTGGTGCACACCGACAGG + Intronic
956644759 3:71444789-71444811 CAGGCCTGCTGCAGACAGAAAGG + Intronic
959774484 3:110140507-110140529 CAGGCCTTAGTCAGAACCAGAGG - Intergenic
960533607 3:118792877-118792899 CAGTGCTGATGCAGATCCTGGGG + Intergenic
961737628 3:129012046-129012068 CAGGCCTGAGGCAGCCACAAAGG + Intronic
961983409 3:131104932-131104954 CAGGATTGGTGCAGAGCCAGAGG - Intronic
962346040 3:134619621-134619643 AAGGCCTCATGCTGACCCATGGG + Intronic
962540364 3:136375641-136375663 CAGGTCTGATGCAGAAACACTGG + Intronic
962952225 3:140229725-140229747 TGGGTCTGATGCAGCCCCAGAGG - Intronic
965758395 3:172049193-172049215 CCTGCCTGAAGCAGACCAAGGGG - Intronic
967503099 3:190222786-190222808 CGGACCTGTTGCTGACCCAGAGG + Intergenic
968089551 3:195891818-195891840 CAGGGCTGGGGGAGACCCAGAGG + Intronic
968685242 4:1953565-1953587 CAGGCCAGACGCAGGCCCATGGG + Intronic
969605820 4:8201818-8201840 CAGGCCTGTTCCTAACCCAGGGG + Intronic
969940319 4:10725273-10725295 CTGGCCTGGTGCAAAGCCAGAGG - Intergenic
971275719 4:25194714-25194736 CAGGGCTGATTCTGAGCCAGAGG - Intronic
974100178 4:57407557-57407579 CAGGCTGGATTCAGACCCAGGGG + Intergenic
975101782 4:70521999-70522021 AAGGGCTGGTGCAGAGCCAGAGG + Intronic
975686871 4:76924821-76924843 GATGCCAGATGCAGTCCCAGCGG - Intergenic
977657892 4:99543857-99543879 CAGGCCTGATGCAATCACAAAGG - Intergenic
978610151 4:110529111-110529133 GAGGCCTGGTGTAGTCCCAGAGG + Intronic
982104168 4:151997410-151997432 CAGGTCTGCTGGAGACCCACAGG + Intergenic
983888748 4:173009335-173009357 GGGGGCTGATGCAGACACAGAGG + Intronic
984241983 4:177228812-177228834 CAGGTCTGATGTGGACCCTGTGG - Intergenic
985647916 5:1093763-1093785 CTGGCTTGCTTCAGACCCAGGGG - Intronic
985769977 5:1803372-1803394 GAGGCCTGATGCACATTCAGTGG + Intronic
985964453 5:3329489-3329511 CAACCCTGATCCTGACCCAGTGG + Intergenic
987143739 5:14970964-14970986 CAGGGGAGGTGCAGACCCAGAGG - Intergenic
987856430 5:23425054-23425076 CAGGCCTGATACATACACACAGG - Intergenic
988075682 5:26351207-26351229 CTGGCATGTTGGAGACCCAGGGG + Intergenic
995194263 5:109346056-109346078 CAGGACTTATGCAGTCCCAGAGG - Intronic
996567144 5:124892371-124892393 CCGGCCTCATCCAGCCCCAGAGG - Intergenic
996579621 5:125016562-125016584 CAGGCCTGATGTTGATTCAGAGG - Intergenic
997614582 5:135237633-135237655 CAGGGCTGACACAGAGCCAGGGG - Intronic
999776797 5:154818302-154818324 CAGGGCTGATGCAGACGGATTGG + Intergenic
1001116915 5:168947704-168947726 GAGGCTGGATGCAGACCCAAGGG + Intronic
1001381696 5:171310076-171310098 CAGGCCCCATGCGGACCCCGTGG - Intronic
1001476410 5:172054137-172054159 CAGGCATGGGGCAAACCCAGGGG + Intronic
1002429994 5:179198012-179198034 CATGCCTGATACTGACCCTGGGG - Intronic
1002440071 5:179259622-179259644 CAGGCCTGTGGCAGTCACAGGGG + Intronic
1002484423 5:179524512-179524534 CAGGGATGATGGAGACCCAAGGG - Intergenic
1002501819 5:179651785-179651807 CAGGGATGATGGAGACCCAAGGG - Intergenic
1002721927 5:181266707-181266729 CAGGCCTGATGCAGACCCACTGG + Intergenic
1003068227 6:2921019-2921041 GAGGCCTGAGGCAGGCACAGGGG - Intergenic
1003886389 6:10524926-10524948 AAAGCCTGATGCAGTCTCAGAGG - Intronic
1004626281 6:17380201-17380223 CAGGCCTGGTCCAGGCACAGTGG - Intergenic
1005704304 6:28436159-28436181 CAGGCCTGATTCTGGCCCACAGG + Exonic
1006172938 6:32105680-32105702 CAGGGCTGAGGCAGAATCAGAGG + Intronic
1006284307 6:33081156-33081178 CAGGCCTGATGAAGTCCCGGGGG - Intronic
1006288704 6:33117430-33117452 CAGGCCTGATGAAGTCCCAGGGG - Intergenic
1006764086 6:36489573-36489595 CAAGCCTGCTCCAGTCCCAGGGG + Exonic
1013627607 6:111953011-111953033 CAGGCATGATGCAGAAGCTGGGG - Intergenic
1015082568 6:129245703-129245725 AAAGCCTGATGCAGAGTCAGTGG - Intronic
1017715335 6:157207047-157207069 CAGGCCTGGTGCTGATCCTGGGG + Exonic
1018949570 6:168370507-168370529 CAGGCCGGATGCAGGCCCAGAGG - Intergenic
1018949589 6:168370567-168370589 CAGCCTGGACGCAGACCCAGAGG - Intergenic
1019180987 6:170187213-170187235 CAGGCCAGGTGCTGACACAGCGG + Intergenic
1019708960 7:2509739-2509761 CAGGCCTGGGGCATCCCCAGAGG - Intergenic
1020005584 7:4782343-4782365 CAGGCCTGCTCCCGACACAGAGG - Intronic
1022254883 7:28646029-28646051 CAACCCTGAAGCAGAGCCAGTGG - Intronic
1023369633 7:39500060-39500082 CAGCCATGGTGCAGGCCCAGAGG - Intergenic
1023763818 7:43492174-43492196 CAAGCATGATACATACCCAGTGG - Exonic
1025751569 7:64298344-64298366 CTTGCCTGATCCACACCCAGAGG - Intergenic
1027960466 7:84939795-84939817 CAGCCCTGATCCAGATGCAGAGG - Intergenic
1028177006 7:87671619-87671641 CAGGCCTGTTGCTGGCCCAAAGG + Intronic
1030128407 7:106176888-106176910 CAGGCCTCATGCAGAATCAGAGG - Intergenic
1031088048 7:117322997-117323019 CTGACCTGATGCAGACGCAAGGG - Exonic
1033039484 7:137905117-137905139 CAGGCCTGATGAAAACCAGGGGG - Intronic
1034782632 7:153894787-153894809 CAGCCAAGATGCAGAACCAGTGG + Intronic
1034796175 7:154015730-154015752 CTGGACTGGTGCAGCCCCAGTGG - Intronic
1035239934 7:157523047-157523069 CAGGCCTGATGGACACACACGGG + Intergenic
1035604179 8:918532-918554 CAGGATCGATGCAGACACAGCGG - Intergenic
1035705026 8:1668894-1668916 CAGGGCTGAAGGAAACCCAGGGG + Intronic
1037883150 8:22582536-22582558 CTTGCCTGGTGCAGAACCAGAGG - Intronic
1040042470 8:42930541-42930563 CTGTTCTGATGCAGACTCAGAGG - Intronic
1040301449 8:46190059-46190081 CAGGCCCGAGGCAGTCCTAGGGG - Intergenic
1040521201 8:48177356-48177378 CAGCCCTCATGCAAACACAGAGG - Intergenic
1046477257 8:114761898-114761920 CAGGCCTGCTTCAGACCCAGCGG - Intergenic
1049164485 8:141117723-141117745 CCGGCCTGAGCCAGGCCCAGGGG + Intronic
1049289766 8:141795584-141795606 CTGGCCTGATGCTGCCCGAGAGG + Intergenic
1049659615 8:143813936-143813958 CAGGCCGTCTGCAGCCCCAGCGG + Intronic
1049800745 8:144516473-144516495 CAGGCCTGATCTAGGCTCAGAGG - Exonic
1053799294 9:41754412-41754434 GAGGAGTGAGGCAGACCCAGGGG + Intergenic
1054145920 9:61560587-61560609 GAGGAGTGAGGCAGACCCAGGGG - Intergenic
1054187703 9:61966471-61966493 GAGGAGTGAGGCAGACCCAGGGG + Intergenic
1054465661 9:65491691-65491713 GAGGAGTGAGGCAGACCCAGGGG - Intergenic
1054650813 9:67622110-67622132 GAGGAGTGAGGCAGACCCAGGGG - Intergenic
1056160426 9:83885719-83885741 GAGGACTGATTCAGCCCCAGAGG - Intronic
1056893834 9:90522440-90522462 TAAGCCTGATTCAAACCCAGGGG - Intergenic
1059139169 9:111835792-111835814 CAGGCCTGGGGAAGGCCCAGTGG - Intergenic
1060269477 9:122130727-122130749 CAGGCCAGATGCAGAACTGGGGG - Intergenic
1060975283 9:127761631-127761653 CAGGGCTGCTGGAGAGCCAGAGG - Exonic
1062394667 9:136348015-136348037 CTGGCCAGCTGCAGACTCAGCGG - Intronic
1062570882 9:137184821-137184843 GAGCCCAGATGCAGACACAGAGG + Intronic
1062688261 9:137827555-137827577 CAGGGCTGGGGCAGACCCAGGGG - Intronic
1186979541 X:14944555-14944577 CAGGCAGGATTGAGACCCAGTGG - Intergenic
1190537690 X:51446214-51446236 CAGGCCTCAGGCAGGTCCAGAGG + Intergenic
1191676526 X:63797409-63797431 CATACCTGATGCAGACCATGTGG + Intergenic
1193289260 X:79752831-79752853 CAGGCCTCATGCAGGTTCAGAGG + Intergenic
1195502167 X:105613881-105613903 CAGGCCCCATGCATGCCCAGAGG - Intronic
1198116269 X:133548157-133548179 CAGGCATGATGCAGCTACAGAGG + Intronic
1199878888 X:151957057-151957079 CAGGGCTCATGCAGGCCCTGTGG + Intronic
1199978575 X:152908556-152908578 TCGGCCTGATGCAGCCACAGAGG - Intergenic
1200835184 Y:7725689-7725711 CAGGCCTCGTGCTGGCCCAGAGG - Intergenic