ID: 925744822

View in Genome Browser
Species Human (GRCh38)
Location 2:7034845-7034867
Sequence ACTCCCGAAGGCTCCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925744822_925744828 -1 Left 925744822 2:7034845-7034867 CCGGCTGGGGAGCCTTCGGGAGT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 925744828 2:7034867-7034889 TGCAGCTGATGGGAAGTTAGGGG 0: 1
1: 0
2: 0
3: 20
4: 230
925744822_925744831 25 Left 925744822 2:7034845-7034867 CCGGCTGGGGAGCCTTCGGGAGT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 925744831 2:7034893-7034915 AGTCGTGATTGGCCTTGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 78
925744822_925744829 14 Left 925744822 2:7034845-7034867 CCGGCTGGGGAGCCTTCGGGAGT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 925744829 2:7034882-7034904 GTTAGGGGCAGAGTCGTGATTGG 0: 1
1: 0
2: 0
3: 10
4: 104
925744822_925744832 26 Left 925744822 2:7034845-7034867 CCGGCTGGGGAGCCTTCGGGAGT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 925744832 2:7034894-7034916 GTCGTGATTGGCCTTGGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 90
925744822_925744826 -3 Left 925744822 2:7034845-7034867 CCGGCTGGGGAGCCTTCGGGAGT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 925744826 2:7034865-7034887 AGTGCAGCTGATGGGAAGTTAGG 0: 1
1: 0
2: 1
3: 14
4: 188
925744822_925744827 -2 Left 925744822 2:7034845-7034867 CCGGCTGGGGAGCCTTCGGGAGT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 925744827 2:7034866-7034888 GTGCAGCTGATGGGAAGTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 130
925744822_925744830 20 Left 925744822 2:7034845-7034867 CCGGCTGGGGAGCCTTCGGGAGT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 925744830 2:7034888-7034910 GGCAGAGTCGTGATTGGCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925744822 Original CRISPR ACTCCCGAAGGCTCCCCAGC CGG (reversed) Intronic