ID: 925746603

View in Genome Browser
Species Human (GRCh38)
Location 2:7048984-7049006
Sequence CCGGGGGCTCAGGATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925746587_925746603 -2 Left 925746587 2:7048963-7048985 CCTCCTAGTCCCTCCTCCCCACC 0: 1
1: 0
2: 0
3: 140
4: 1115
Right 925746603 2:7048984-7049006 CCGGGGGCTCAGGATGTGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 241
925746589_925746603 -5 Left 925746589 2:7048966-7048988 CCTAGTCCCTCCTCCCCACCGGG 0: 1
1: 0
2: 2
3: 52
4: 450
Right 925746603 2:7048984-7049006 CCGGGGGCTCAGGATGTGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 241
925746586_925746603 30 Left 925746586 2:7048931-7048953 CCGTGGCAACTGAGAATGATAGA 0: 1
1: 0
2: 1
3: 14
4: 170
Right 925746603 2:7048984-7049006 CCGGGGGCTCAGGATGTGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925746603 Original CRISPR CCGGGGGCTCAGGATGTGGT GGG Intronic
900251780 1:1674736-1674758 CCGAGGGTCCAGGATGGGGTTGG - Intronic
900262188 1:1737592-1737614 CCGAGGGTCCAGGATGGGGTTGG - Intronic
900366605 1:2314344-2314366 CACGGGGCGCAGGATGGGGTAGG - Intergenic
901075873 1:6554407-6554429 CCGGCGGCTGAGGATGAGCTGGG + Exonic
901448888 1:9324370-9324392 CCTGTGGCTCAGCACGTGGTAGG + Intronic
901626879 1:10629719-10629741 CTGGGGGCCCAGCAAGTGGTAGG - Exonic
901630386 1:10645148-10645170 CCCGGGCCTGAGGCTGTGGTGGG + Intronic
902557638 1:17256405-17256427 CCGAGGGCTCAGGTGGTGCTGGG - Intronic
902617916 1:17634017-17634039 CCGGGAGCTCAGGGCCTGGTTGG + Intronic
903121769 1:21220841-21220863 CCGGGATCTCAGGATCAGGTGGG - Intronic
903139690 1:21332088-21332110 CTGGGTGCTGAGGATGGGGTGGG - Intronic
905287417 1:36890575-36890597 CTGGTGGCTCAGTATGTGGAGGG + Intronic
907284016 1:53368865-53368887 CCCAGGGCTCAGGCTGTGGGTGG - Intergenic
908523735 1:64968027-64968049 GCATGGGCTCAGGAAGTGGTAGG + Intergenic
908572168 1:65420988-65421010 CCGAGGGCTCAGGCTGGGGAGGG - Intronic
912797840 1:112703601-112703623 GCGGGGTCTCAGGGTGGGGTGGG + Intronic
914666884 1:149840106-149840128 CCGGGGGCACGGGGTGTGGGCGG - Exonic
914668883 1:149853684-149853706 CCGGGGGCACGGGGTGTGGGCGG + Exonic
915675331 1:157524500-157524522 CCCAGGGCCCAGGCTGTGGTGGG - Exonic
915675697 1:157527838-157527860 CCCAGGGCCCAGGCTGTGGTGGG - Exonic
915690988 1:157690476-157690498 CCCGGGGCCCAGGCTGTGGTGGG - Exonic
915835351 1:159171695-159171717 CCGGGGGCTGGGGATGGGGAGGG - Exonic
919803255 1:201366095-201366117 CCTGGGTCTCAGTATGTGTTGGG - Intronic
921367198 1:214384565-214384587 CCGGTGGCTCGGGATGTAGTCGG + Exonic
922414526 1:225408468-225408490 CTTGGGGCTCAGGAGCTGGTGGG - Intronic
922900146 1:229130247-229130269 CAGAGGACTCAGGATGTGGTTGG + Intergenic
1063663293 10:8048225-8048247 CAGGGGGCTCAGGAGCTGGGTGG + Intergenic
1064645349 10:17454246-17454268 CCTGTGGCTCAGGATGCGGCCGG - Exonic
1065892062 10:30129920-30129942 CCAGGGGCTCAGGGTGTGGATGG - Intergenic
1067710561 10:48648318-48648340 CCAGGCCCCCAGGATGTGGTGGG + Intronic
1068682368 10:59834014-59834036 CCAGGTGCACAGGGTGTGGTAGG - Intronic
1070646465 10:78205351-78205373 CCTGGGTGTCAGGATGTGGGTGG + Intergenic
1072718873 10:97768769-97768791 CCTGGGCCTCAGGGTGGGGTGGG + Intronic
1073189716 10:101642760-101642782 CCTGTGGCTCATGATGTGTTTGG - Intronic
1074408401 10:113201337-113201359 CCTGGGGTTCAGGATGGGGTAGG - Intergenic
1075615131 10:123885201-123885223 CTGGGGACTCAGGGTGGGGTTGG + Intronic
1076191657 10:128487521-128487543 CCCGGGGGTCTGGGTGTGGTGGG + Intergenic
1076511869 10:131019879-131019901 CCGGTGGCTCAGGCAGTGCTGGG - Intergenic
1076785720 10:132748950-132748972 CCTGGGGCGCAGGCTGGGGTGGG - Intronic
1076871822 10:133198305-133198327 CAGGGGGCTGAGGGTGTGGGCGG - Intronic
1077094201 11:792477-792499 CCGTGGGGACAGGAGGTGGTGGG + Intronic
1077230258 11:1455466-1455488 CCGGGGGCAGAGCATATGGTGGG - Intronic
1077258954 11:1605167-1605189 CCAGGGGCTCAGGGTGTGGCTGG - Intergenic
1077474613 11:2780462-2780484 CCAGGGGCTCTGGCTGGGGTTGG - Intronic
1077524786 11:3057495-3057517 CCAGGGGCTCCGGATGTCGCCGG + Intronic
1080702178 11:34653249-34653271 CCTGAGGCTCAGGAAGTGGTTGG - Intronic
1081348953 11:42025711-42025733 CCGGGGGTTGGGGAAGTGGTTGG + Intergenic
1083816696 11:65136569-65136591 AAAGGGGATCAGGATGTGGTGGG + Intergenic
1084802582 11:71554861-71554883 CCAGGGACTCAGGGTGTGGCTGG + Intronic
1089643239 11:119861288-119861310 CCTGGGGCCCAGGATGGGGAGGG - Intergenic
1090487705 11:127128882-127128904 CTGGGGGCTCAGGATCTGGTTGG - Intergenic
1090576186 11:128106360-128106382 CGAGGGGCTGAGGATGTGGGTGG - Intergenic
1091097907 11:132841276-132841298 CCGGGGGGTCAGTAAGTGCTAGG - Intronic
1091301337 11:134510014-134510036 CTGGGAGCTGAGGATGTGGAGGG - Intergenic
1091747032 12:2999235-2999257 CTGGGGGCTCAGAATGGGGCTGG - Intronic
1092578431 12:9814398-9814420 CTCAGGGCTCAGGCTGTGGTTGG - Intergenic
1094207087 12:27851919-27851941 CCTGGAGCTCAAGATGGGGTGGG - Intergenic
1095977157 12:47947540-47947562 GCTGGGGCTCAGGCTGTGGGAGG + Intergenic
1096005431 12:48166612-48166634 CCTGGGCCTCACAATGTGGTGGG - Intronic
1096538762 12:52291439-52291461 CCTGCGGATCAGGATTTGGTGGG - Exonic
1096710319 12:53450966-53450988 CAGGAGGCTGAGGTTGTGGTGGG + Intergenic
1096790334 12:54040393-54040415 CCAGGAGCTAAGGCTGTGGTGGG - Intronic
1098167732 12:67715338-67715360 CCTGGGGCTCATGATGGGGAGGG + Intergenic
1098298790 12:69032369-69032391 CCGGGAGCTTAGCATGTGGCAGG + Intergenic
1098525225 12:71479838-71479860 CCAGTGGCTCAGGATGAGGATGG + Intronic
1101593707 12:106144776-106144798 CCTGGGGCTGAGAATGTGCTGGG + Intergenic
1101691562 12:107087239-107087261 CAGTGTGCTCAGGATGTGGGAGG + Intronic
1101869995 12:108558301-108558323 CTGTGGGATCAGGATGAGGTGGG + Intronic
1102884729 12:116512885-116512907 TATGGGGCTCAGGATCTGGTCGG - Intergenic
1103884236 12:124188901-124188923 GCGGGGGCGCAGGCTGTGTTTGG + Intronic
1104900502 12:132187438-132187460 CGGGGGCCTCAGGATGTCGACGG + Intergenic
1105668693 13:22588620-22588642 CTGAGGGCTCAGGAAGTGGAAGG + Intergenic
1106450928 13:29881512-29881534 CCTTGGGCACAGCATGTGGTAGG + Intergenic
1107986397 13:45780228-45780250 CAGGGGGCCCAGGAAGTGGGTGG - Exonic
1108264766 13:48695584-48695606 CCGGGGATTAAGAATGTGGTGGG - Intronic
1115566538 14:34629843-34629865 CCGGGGACCCAGGATGGGGAAGG + Intronic
1119481681 14:74962039-74962061 CCGGGAACTAAGGATGTGGTGGG - Intergenic
1122810343 14:104284583-104284605 CCTAGGGCTCAGGGTGAGGTGGG + Intergenic
1122859089 14:104574206-104574228 CCTGGGGCTCAGGAGGCGGTGGG + Intronic
1124366394 15:29074483-29074505 GCAGGGGCTCAGGTTGGGGTTGG + Intronic
1126444035 15:48721731-48721753 CTGAGGGCTCAGGAAGTGGGAGG + Intronic
1129705256 15:77790674-77790696 CGGGGGGCCCAGCACGTGGTGGG - Intronic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1132724045 16:1331191-1331213 CCTGGGGCTCAGGGTGGGGAGGG + Intergenic
1133295531 16:4750111-4750133 CTGGGGGCTCAGGCTGCGCTGGG + Exonic
1133732561 16:8589684-8589706 CCGGGGGCGCAGGACCTGCTGGG - Exonic
1134109604 16:11506874-11506896 CCGGGGGCCCAGGAGCTGCTTGG + Intronic
1134262841 16:12666476-12666498 CCTGGGGCTGGGGAAGTGGTAGG + Intronic
1134408889 16:13986668-13986690 CCTGGGGCTGAGGATGAGATAGG - Intergenic
1135607254 16:23835733-23835755 CCGGGGGCCGAGGACGGGGTGGG + Intergenic
1136408818 16:30064889-30064911 CAGGGGGCTCAGCATCTGGGAGG + Intronic
1136536259 16:30901682-30901704 CCGGAGGCTGAGGCTGAGGTGGG - Intronic
1136922373 16:34343803-34343825 GGGAGGGCTCAGGATGTGGGAGG - Intergenic
1136933384 16:34437424-34437446 ACAGGGTCTCAGGATGTGGCAGG + Intergenic
1136971188 16:34974390-34974412 ACAGGGTCTCAGGATGTGGCAGG - Intergenic
1136982200 16:35068003-35068025 GGGAGGGCTCAGGATGTGGGAGG + Intergenic
1138578477 16:57923909-57923931 CCTGGGGCTCAGGAGGGGATGGG - Intronic
1139322794 16:66129074-66129096 CCAGGGGATCAGGCTGAGGTTGG - Intergenic
1139910696 16:70395614-70395636 CCTGGGGCTCAGGGAGTGGCTGG - Intronic
1141954120 16:87358806-87358828 ACTGGGGCTCAGGAGGTGGGAGG + Intronic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1143992277 17:10976076-10976098 TCAGGGGCTCAGAATGTAGTAGG - Intergenic
1144092651 17:11871892-11871914 CCTGGTGCTCAGGGGGTGGTGGG - Intronic
1144855451 17:18264893-18264915 CCAGGGCATCAGGATGTGCTTGG + Exonic
1146255808 17:31391254-31391276 CCGAGCGCTCAGGATGTCCTGGG - Intergenic
1147365716 17:39957838-39957860 GCAGGGGCTCAGGAAGAGGTGGG + Intergenic
1147647194 17:42040811-42040833 CCGGGGGCTCAGGATCTGTCCGG + Intronic
1149610398 17:57954968-57954990 CCCGGGGCCCGGGATGAGGTGGG + Intronic
1150946777 17:69755238-69755260 CCTGGGTCTCAGGATGTTATTGG - Intergenic
1151920784 17:77153665-77153687 CCTGGGGCTGAGGAGGTGGGTGG + Intronic
1151955724 17:77379234-77379256 CCGGGGTGTCAGGAGGTGGAGGG + Intronic
1152644098 17:81460914-81460936 ACGGCGGCCCAGGAAGTGGTCGG - Exonic
1152644379 17:81462010-81462032 CCGGCAGCTCTGGAAGTGGTCGG + Exonic
1152645276 17:81465765-81465787 CTGGGGGCTTATGTTGTGGTCGG + Exonic
1153816608 18:8795784-8795806 CAGGGGGCTCAGGAAGTAGAGGG + Intronic
1157125605 18:44952885-44952907 CCGCTCGCTCAGGATGTGGCTGG - Exonic
1157552806 18:48593087-48593109 CAGGGGGCTCTGTATCTGGTGGG + Intronic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1161408362 19:4102772-4102794 CCGGGGGCTCAGGCAGCTGTGGG + Intronic
1161981486 19:7632616-7632638 CTGGGGGCACGGGATGTGGGAGG - Intronic
1162965002 19:14151370-14151392 CAGGGGGCTCAGGCGGTGGAGGG + Exonic
1164389441 19:27805375-27805397 CCGGGTGCTCTGGAGGTGCTGGG + Intergenic
1165256541 19:34579924-34579946 CCTGGGGCTGAGGATGGGGCTGG + Intergenic
1165898640 19:39157726-39157748 CGAGGTGCTCAGGATGTTGTAGG + Intronic
1166746536 19:45144582-45144604 CCAGGGGCCCAGGCTGTGGGGGG + Intronic
1168171106 19:54589863-54589885 TCGGGGGCTCAGGTTCAGGTTGG - Intronic
1168401793 19:56089452-56089474 CCGGGGGCAGAGGATGAGGAAGG + Intronic
1168405901 19:56110567-56110589 CTTGGGGCTGAGGAGGTGGTGGG + Intronic
1168467969 19:56619316-56619338 CCGGGGGCTGAGGAGTGGGTGGG - Intronic
1168705923 19:58470266-58470288 TCTGGGGCTCATGGTGTGGTGGG + Intronic
925746603 2:7048984-7049006 CCGGGGGCTCAGGATGTGGTGGG + Intronic
926748803 2:16181860-16181882 CCGTGGTCTGCGGATGTGGTGGG + Intergenic
926783475 2:16497423-16497445 CCTGAGTCTCAGGTTGTGGTTGG - Intergenic
929326464 2:40617576-40617598 TTGGGGGCTCAGGAGGAGGTGGG - Intergenic
930561014 2:52959905-52959927 CCACAGGCTCAGGATGCGGTGGG + Intergenic
935744574 2:106179243-106179265 GCGGGGGTTCAGGGTGGGGTGGG - Intronic
937265374 2:120611927-120611949 GAGGAGGCTCAGGATGGGGTTGG - Intergenic
938741863 2:134239692-134239714 CCTGGGGATGAGGATGTGGATGG + Intronic
940036891 2:149320723-149320745 CCTGGGGCTCAGGAAGTAGAAGG - Intergenic
940522059 2:154763503-154763525 CCGGGGACACAGAATGTGATAGG + Intronic
946017672 2:216617041-216617063 TCAGGGGATCAGGAGGTGGTGGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1168839296 20:898934-898956 CCAGGGGCTCTGGGTGTGGTTGG - Intronic
1168914880 20:1477449-1477471 CCTGGGACTTAGGAAGTGGTGGG - Intronic
1169392215 20:5199343-5199365 CGGGGGGCTCTGGATATGGAAGG - Intergenic
1169578641 20:6994293-6994315 GCAGGGGCTAAGGATGGGGTGGG + Intergenic
1172383632 20:34516797-34516819 CCGGGAGCTCAGTTTGTGGCAGG + Intronic
1172808157 20:37628059-37628081 CCTGGGGCTCAGGAAGAGGTGGG - Intergenic
1173328586 20:42055539-42055561 CTGGGGGCAAGGGATGTGGTTGG + Intergenic
1173709714 20:45143851-45143873 CCGGGGGATGAGGAGGGGGTTGG + Intergenic
1173973972 20:47173390-47173412 CCGGGGGATGCTGATGTGGTTGG - Intronic
1175679616 20:60976500-60976522 TCAGGGCCACAGGATGTGGTGGG + Intergenic
1176197369 20:63843687-63843709 CCGGGGCCTCTGGAAGTGGAAGG + Intergenic
1176796111 21:13372184-13372206 CCGGGGGCTAAGCTTGTGGTGGG - Intergenic
1179304559 21:40142456-40142478 CAAGGGGCTCAGGATATGGCGGG - Intronic
1179725413 21:43338963-43338985 CAGGGGCCACAGGCTGTGGTGGG + Intergenic
1179933985 21:44591059-44591081 CGGGGGGCACAGGGTGAGGTGGG - Intronic
1181534785 22:23535764-23535786 TCAGGGGCTGAAGATGTGGTGGG - Intergenic
1182351957 22:29704361-29704383 CGGGGTGGTCAGGAGGTGGTGGG - Intergenic
1182423993 22:30262643-30262665 CCGGGGGCTGTGACTGTGGTGGG - Intergenic
1184691406 22:46119048-46119070 CTGGGGGGTCTGGGTGTGGTGGG + Intergenic
1184807195 22:46802835-46802857 CCGTGGGCTGGGGATGTGGGTGG + Intronic
1185191006 22:49436010-49436032 GCAGGGGCTCAGGGTGCGGTCGG - Intronic
1185306977 22:50124622-50124644 CCAGGGCCTCAGCATGAGGTGGG - Intronic
1185393973 22:50577620-50577642 AGGGGTGCACAGGATGTGGTCGG - Intronic
950113081 3:10432920-10432942 CTGGGGGCTCTGGCTGGGGTAGG + Intronic
950661548 3:14469789-14469811 CAGGGGTCTCAGGATGGGGCTGG - Intronic
953434076 3:42864954-42864976 CCGGGTCCTCAGCCTGTGGTAGG - Exonic
959817539 3:110692575-110692597 CTGGGGGTTGAGGTTGTGGTGGG - Intergenic
961651909 3:128421043-128421065 CCTGGGGCCCAGGATGGGGTGGG - Intergenic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961858269 3:129893746-129893768 CCGGGGGCGGAGGTTGTGGGCGG - Intergenic
962479459 3:135785939-135785961 CTCTGGGCTCTGGATGTGGTGGG - Intergenic
963082020 3:141402795-141402817 CCCGGGGCTGGGGACGTGGTGGG + Intronic
963913219 3:150832726-150832748 CGTGGGGCTCAGGTTGAGGTGGG + Intergenic
966830439 3:184003364-184003386 CTGGGGAGTAAGGATGTGGTGGG - Intronic
967183343 3:186925605-186925627 CCAGGGACTTAGGATGGGGTTGG + Intergenic
968016368 3:195337918-195337940 CCCCGGGCTCAGGTTGAGGTGGG - Intronic
968649165 4:1753612-1753634 TCAGGGGCTCAGCATGTGGGCGG + Intergenic
970243296 4:14031685-14031707 CTCGGGGCTCAGGATTTGGTAGG + Intergenic
978447088 4:108789833-108789855 CCAGAGGGTCAGGATGGGGTGGG + Intergenic
980788468 4:137586327-137586349 TTGGGGGCTCACGATGTGATTGG + Intergenic
983050308 4:163038485-163038507 CCGGAGGCGGAGGTTGTGGTGGG - Intergenic
983296440 4:165873892-165873914 CCGGGGGAGGAGGATGGGGTTGG + Exonic
985555315 5:555270-555292 CAGGCGGTTCAGGGTGTGGTGGG + Intergenic
985679226 5:1247235-1247257 CTGTGGGCTCAGGATGCGCTTGG - Intergenic
985996881 5:3602075-3602097 CGAGGGGCTGAGGCTGTGGTGGG + Intergenic
987228603 5:15869335-15869357 CCTGGGGAGCATGATGTGGTAGG - Intronic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
988508681 5:31846766-31846788 CTGGTGGCCCTGGATGTGGTCGG + Intronic
988542776 5:32126821-32126843 CCTGTGGCTGAGGATGTGCTGGG - Intronic
988816682 5:34840970-34840992 CCGGAGGCAGAGGTTGTGGTGGG + Intronic
989674699 5:43960108-43960130 CCGGGGCCTCAGGGGGTGGGGGG - Intergenic
993026176 5:82649493-82649515 AAGGGGGCTCTGAATGTGGTGGG + Intergenic
993901581 5:93587695-93587717 CCAGGGGCTCAGGCAGTGGCTGG + Intronic
1001654414 5:173338582-173338604 CTGGAGGCCCAGCATGTGGTGGG + Intergenic
1001989626 5:176105556-176105578 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002194671 5:177495454-177495476 CCTGGGGGTCAGGAGGGGGTGGG - Intronic
1002227244 5:177732582-177732604 CAGGTGGCACAGGTTGTGGTGGG - Intronic
1002266898 5:178041188-178041210 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002886412 6:1299284-1299306 CCTGGGGCTAAGGATGGGGCAGG + Intergenic
1004014552 6:11720161-11720183 AAGGGGGCTCAGGCTGTGGAAGG + Intronic
1004650263 6:17600930-17600952 CCCGGGGCTCAGGAAGTAGAAGG - Exonic
1005826294 6:29633205-29633227 CCCGGGGCTCGGGTTGTGGGAGG - Intronic
1010794854 6:80106861-80106883 CCCGGGGCTCCGGATCTGGCTGG - Exonic
1012547248 6:100433626-100433648 CCGGAGGCTGAGGCTGTGGGAGG + Intronic
1013005844 6:106072715-106072737 CCCGGGGCTCATGATGTAGATGG - Intergenic
1013015151 6:106154441-106154463 CAAGCGGCCCAGGATGTGGTAGG - Intergenic
1018034023 6:159866633-159866655 GCGGGGGCTCGGGAGGTGGCCGG + Intergenic
1019035022 6:169047448-169047470 CTGGGGGCTCAGGGTGTGATGGG + Intergenic
1019739522 7:2665800-2665822 CTGGGGGCTCAGGAAGAGCTCGG - Intergenic
1022567215 7:31415690-31415712 CCTGGGACTTAGGATGTGTTTGG - Intergenic
1023845591 7:44118251-44118273 CCAGGGACTCTGGGTGTGGTTGG + Intronic
1026955488 7:74373862-74373884 CCTGGGGCTGAGGAAGGGGTGGG + Intronic
1029283878 7:99453193-99453215 CATTGGGCTCAGGAGGTGGTTGG - Intronic
1032398475 7:131607634-131607656 CCGGGGGCTCAGATGATGGTCGG + Intergenic
1032786189 7:135201934-135201956 CAGGGGGCCCAGGATGTGAGGGG + Intronic
1033284264 7:140026944-140026966 CCTGGGGCTAATGGTGTGGTGGG + Intronic
1033361031 7:140639276-140639298 CCGGGGGCTGAGGTTGCAGTGGG + Intronic
1034433545 7:151052453-151052475 CCTGGGGCCCAGGCTGAGGTGGG - Exonic
1034552912 7:151832630-151832652 CGGGGGGCTCACGCTGTGGAAGG - Intronic
1034567885 7:151930022-151930044 CCGTGGGCTCCCGAGGTGGTGGG + Intergenic
1035018306 7:155785541-155785563 CTGGGGGCTCAGGAAGGGGATGG - Intergenic
1035563523 8:626730-626752 CCAGGGGCTCAGGATGAGGATGG - Intronic
1036072515 8:5456897-5456919 CCCGGGGCTCAGGCTTTGGAGGG - Intergenic
1037539977 8:19861771-19861793 CCGAGAGCTCAGGCTGTGATGGG - Intergenic
1037717098 8:21409873-21409895 CAGGGTGCTGAGGATGTGGCTGG - Intergenic
1049410758 8:142473024-142473046 CCAGGTGGTGAGGATGTGGTAGG - Intronic
1050456470 9:5839617-5839639 AGGGGGGCTCAGGAAGTGCTGGG - Intergenic
1052813750 9:33083934-33083956 TCTGGGGCTGAGGATGAGGTAGG + Intergenic
1053123036 9:35560401-35560423 CCGGGGGCTCAGGGCGTGCCAGG + Exonic
1053283109 9:36834268-36834290 CCCGGGGCTCAGGAAGAGGCAGG - Exonic
1053886143 9:42646164-42646186 CCAGGGGCTAAGTTTGTGGTGGG + Intergenic
1053907111 9:42852882-42852904 CGGGGGGCTCAGCCTGGGGTGGG + Intergenic
1054225163 9:62453613-62453635 CCAGGGGCTAAGTTTGTGGTGGG + Intergenic
1056659540 9:88534430-88534452 GCGGGGGCGCGGGATGTGGTAGG + Intergenic
1057152929 9:92809874-92809896 TCGGGGGCTCAGCCTGCGGTGGG + Intergenic
1057353587 9:94318780-94318802 CCAGGGCCTCAGCCTGTGGTGGG + Exonic
1057390837 9:94640217-94640239 CCAGGGGGTCAGGATGCGGGCGG - Exonic
1057530696 9:95843076-95843098 CCAGGGACTAAGGATGGGGTTGG - Intergenic
1057654164 9:96938812-96938834 CCAGGGCCTCAGCCTGTGGTGGG - Exonic
1057816406 9:98299192-98299214 CCAGGGCCCCAGAATGTGGTAGG - Intronic
1058645856 9:107131031-107131053 CCTGGGGCTAAGGAGGTGGAAGG - Intergenic
1059154937 9:111981275-111981297 CTGGGGGCACTGGACGTGGTGGG - Intergenic
1061420597 9:130471237-130471259 CCCGGGGCTCTGCACGTGGTTGG - Intronic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1062003049 9:134226426-134226448 CCAGGGGCTCAGGAGGAGATGGG - Intergenic
1062209478 9:135356012-135356034 CCGGGGGCTCCGGCTGGGGAGGG - Intergenic
1062275507 9:135728546-135728568 CCGGGGGAACAGGAAGTGGGAGG + Intronic
1062352500 9:136145913-136145935 CCCTGGGGTCAGGATGTGGGTGG + Intergenic
1062585501 9:137247630-137247652 CCGGGAGCTCTGGAGGTGGCTGG - Intronic
1062630288 9:137460255-137460277 CCGGGGCCCCAGGCTGTGTTAGG - Exonic
1186434866 X:9533919-9533941 CCAGGAGCTCAGGAGCTGGTAGG + Intronic
1187487215 X:19715917-19715939 CCAGGGGCTCAGGGGGTGGGGGG + Intronic
1189227706 X:39427197-39427219 TAGGGGGCTTAGGATCTGGTGGG + Intergenic
1194580652 X:95666423-95666445 CTGGGTGCTCTGGATGAGGTGGG + Intergenic
1198539506 X:137621724-137621746 CTGGGAGCTGAGGTTGTGGTGGG + Intergenic
1199242860 X:145568793-145568815 GCATGGGTTCAGGATGTGGTGGG - Intergenic
1200064632 X:153498568-153498590 CCGGGGGCTCAGGCTGGGCTGGG - Intronic
1200223609 X:154404551-154404573 GCTGGGGCTCAGGGTGTGGCTGG - Intronic
1202377938 Y:24255339-24255361 GCTGGGGCTCAGGGTGGGGTGGG - Intergenic
1202492844 Y:25414782-25414804 GCTGGGGCTCAGGGTGGGGTGGG + Intergenic