ID: 925750661

View in Genome Browser
Species Human (GRCh38)
Location 2:7088520-7088542
Sequence GAGCCTAGCAAGGATGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925750654_925750661 13 Left 925750654 2:7088484-7088506 CCGAATAGGCCACACATGTTTCT No data
Right 925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG No data
925750657_925750661 4 Left 925750657 2:7088493-7088515 CCACACATGTTTCTTGGAAGGAG No data
Right 925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925750661 Original CRISPR GAGCCTAGCAAGGATGCTAC GGG Intergenic
No off target data available for this crispr