ID: 925753223

View in Genome Browser
Species Human (GRCh38)
Location 2:7108721-7108743
Sequence CTAGGTCAGCTATTCATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925753223_925753228 24 Left 925753223 2:7108721-7108743 CCATCCATGAATAGCTGACCTAG No data
Right 925753228 2:7108768-7108790 TGGCTCATAGGACCACATTGCGG No data
925753223_925753226 4 Left 925753223 2:7108721-7108743 CCATCCATGAATAGCTGACCTAG No data
Right 925753226 2:7108748-7108770 GTTTTAAAAATCTTCACTTTTGG No data
925753223_925753227 12 Left 925753223 2:7108721-7108743 CCATCCATGAATAGCTGACCTAG No data
Right 925753227 2:7108756-7108778 AATCTTCACTTTTGGCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925753223 Original CRISPR CTAGGTCAGCTATTCATGGA TGG (reversed) Intergenic
No off target data available for this crispr