ID: 925753558

View in Genome Browser
Species Human (GRCh38)
Location 2:7111173-7111195
Sequence TGTCCTTTAGATATCTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925753553_925753558 20 Left 925753553 2:7111130-7111152 CCATGCCTGGCTTTTTTTTTTTT 0: 416
1: 1570
2: 7108
3: 24502
4: 98839
Right 925753558 2:7111173-7111195 TGTCCTTTAGATATCTTGAGGGG No data
925753552_925753558 23 Left 925753552 2:7111127-7111149 CCACCATGCCTGGCTTTTTTTTT 0: 322
1: 1716
2: 20552
3: 84100
4: 163444
Right 925753558 2:7111173-7111195 TGTCCTTTAGATATCTTGAGGGG No data
925753554_925753558 15 Left 925753554 2:7111135-7111157 CCTGGCTTTTTTTTTTTTTTTAA 0: 60
1: 447
2: 4367
3: 18820
4: 69453
Right 925753558 2:7111173-7111195 TGTCCTTTAGATATCTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925753558 Original CRISPR TGTCCTTTAGATATCTTGAG GGG Intergenic
No off target data available for this crispr