ID: 925754318

View in Genome Browser
Species Human (GRCh38)
Location 2:7119278-7119300
Sequence ATGTTGGGCCTTTTCTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925754318_925754320 -8 Left 925754318 2:7119278-7119300 CCAAAAGAGAAAAGGCCCAACAT No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925754318 Original CRISPR ATGTTGGGCCTTTTCTCTTT TGG (reversed) Intergenic
No off target data available for this crispr