ID: 925754320

View in Genome Browser
Species Human (GRCh38)
Location 2:7119293-7119315
Sequence CCCAACATGAGATTCAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925754315_925754320 8 Left 925754315 2:7119262-7119284 CCAGAGATATTTTTACCCAAAAG No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data
925754310_925754320 25 Left 925754310 2:7119245-7119267 CCAGGGCCCGGGCCAGCCCAGAG No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data
925754312_925754320 18 Left 925754312 2:7119252-7119274 CCGGGCCAGCCCAGAGATATTTT No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data
925754318_925754320 -8 Left 925754318 2:7119278-7119300 CCAAAAGAGAAAAGGCCCAACAT No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data
925754314_925754320 9 Left 925754314 2:7119261-7119283 CCCAGAGATATTTTTACCCAAAA No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data
925754313_925754320 13 Left 925754313 2:7119257-7119279 CCAGCCCAGAGATATTTTTACCC No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data
925754311_925754320 19 Left 925754311 2:7119251-7119273 CCCGGGCCAGCCCAGAGATATTT No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data
925754317_925754320 -7 Left 925754317 2:7119277-7119299 CCCAAAAGAGAAAAGGCCCAACA No data
Right 925754320 2:7119293-7119315 CCCAACATGAGATTCAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925754320 Original CRISPR CCCAACATGAGATTCAAACT TGG Intergenic
No off target data available for this crispr