ID: 925758568

View in Genome Browser
Species Human (GRCh38)
Location 2:7160355-7160377
Sequence TTCTTTTACCACTTCTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925758565_925758568 5 Left 925758565 2:7160327-7160349 CCTGTATCATTTTCCCTCTCTGA No data
Right 925758568 2:7160355-7160377 TTCTTTTACCACTTCTTGCAAGG No data
925758567_925758568 -9 Left 925758567 2:7160341-7160363 CCTCTCTGAAGATGTTCTTTTAC No data
Right 925758568 2:7160355-7160377 TTCTTTTACCACTTCTTGCAAGG No data
925758566_925758568 -8 Left 925758566 2:7160340-7160362 CCCTCTCTGAAGATGTTCTTTTA No data
Right 925758568 2:7160355-7160377 TTCTTTTACCACTTCTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925758568 Original CRISPR TTCTTTTACCACTTCTTGCA AGG Intergenic
No off target data available for this crispr