ID: 925759628

View in Genome Browser
Species Human (GRCh38)
Location 2:7171880-7171902
Sequence GACCAGTGACCTTAGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925759624_925759628 22 Left 925759624 2:7171835-7171857 CCTGGGCTCTGGTCTCATTGGCA No data
Right 925759628 2:7171880-7171902 GACCAGTGACCTTAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925759628 Original CRISPR GACCAGTGACCTTAGAGGAG AGG Intergenic
No off target data available for this crispr