ID: 925764343

View in Genome Browser
Species Human (GRCh38)
Location 2:7216337-7216359
Sequence CCTGGTCTATGCCATCGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925764343_925764350 15 Left 925764343 2:7216337-7216359 CCCTAACGATGGCATAGACCAGG No data
Right 925764350 2:7216375-7216397 ACTTCTCTTAGTGTCTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925764343 Original CRISPR CCTGGTCTATGCCATCGTTA GGG (reversed) Intergenic
No off target data available for this crispr