ID: 925768881

View in Genome Browser
Species Human (GRCh38)
Location 2:7263170-7263192
Sequence GTGGCTTCTGGGAGACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925768876_925768881 0 Left 925768876 2:7263147-7263169 CCGGTCTTTCAAGCATTGAGTCT No data
Right 925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG No data
925768875_925768881 1 Left 925768875 2:7263146-7263168 CCCGGTCTTTCAAGCATTGAGTC No data
Right 925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925768881 Original CRISPR GTGGCTTCTGGGAGACATCT GGG Intergenic
No off target data available for this crispr