ID: 925772496

View in Genome Browser
Species Human (GRCh38)
Location 2:7297195-7297217
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 16, 1: 226, 2: 236, 3: 134, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925772496_925772499 5 Left 925772496 2:7297195-7297217 CCCATTGATCTTAATCACAGGGC 0: 16
1: 226
2: 236
3: 134
4: 131
Right 925772499 2:7297223-7297245 AATACTAAGAGATGCCCTAATGG 0: 96
1: 173
2: 206
3: 192
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925772496 Original CRISPR GCCCTGTGATTAAGATCAAT GGG (reversed) Intergenic
904578007 1:31517944-31517966 GCCCTTTGATTAAGGTCAATGGG + Intergenic
905354333 1:37370633-37370655 GCCCTGTGATTAAGGTCAATGGG + Intergenic
906050737 1:42869259-42869281 GCCCTGTGACTAAGGTCAGTGGG + Intergenic
906930666 1:50166674-50166696 GCCCTGTGATTAAGGTCAATGGG - Intronic
907597600 1:55733971-55733993 GCCCTGTGATTAAGGTCAATGGG + Intergenic
907780635 1:57563003-57563025 GCCCTGTGATTAAGGTCAATGGG + Intronic
908052570 1:60248551-60248573 GCCCTGTGATTAAGGTCAATGGG + Intergenic
908737652 1:67292655-67292677 GCCCTATGATTAAGGTCAATGGG + Intergenic
909032628 1:70560443-70560465 GCTGTGTGTTTAAGATCGATGGG - Intergenic
909172362 1:72313618-72313640 GCCTTGTGATTAAGGTCAATGGG - Intergenic
909548690 1:76875332-76875354 GCCCTGTGATTAAAGTCAATGGG - Intronic
909577175 1:77187683-77187705 GCCCTGTGATTAAGGTCAATGGG + Intronic
909858667 1:80575192-80575214 GCCCTGTGATTAATGTCAATGGG - Intergenic
910562147 1:88601809-88601831 GCCCTGTGATTAAGGTCAACGGG + Intergenic
910588471 1:88903572-88903594 GCCCTGTGATAAAGGTCAATGGG + Intergenic
910630466 1:89348107-89348129 GCCCTGTGATTAAGGTCAATGGG + Intergenic
910790542 1:91045286-91045308 GCCCTGTGATAAAGGTCAATGGG + Intergenic
910791556 1:91056298-91056320 GCCCTGTGATTAAGGTCAATGGG - Intergenic
910830839 1:91461571-91461593 GCCCTGTGATAAAGGTCAAAGGG - Intergenic
910948467 1:92618557-92618579 GCCCTGTGATTAAGGTCAATGGG + Intronic
911108914 1:94162855-94162877 GCTCTGTGATTAAGGTCAATAGG - Intronic
911257083 1:95645511-95645533 GCCCTGTGATTAAGGTCAATGGG - Intergenic
911403612 1:97408083-97408105 GCCCTATGATTAACGTCAATGGG + Intronic
911738148 1:101360083-101360105 GCCCTGAGATTAAGGTCAATGGG - Intergenic
911831719 1:102557779-102557801 GCTCTGTTATTAAGGTCAATGGG - Intergenic
911980658 1:104561248-104561270 GCTCTGTGATTAAGGTCAATGGG + Intergenic
912050451 1:105523091-105523113 GCCCTGTGATTAAGGTAAATGGG - Intergenic
912129663 1:106586217-106586239 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
912251779 1:108019630-108019652 GCCCTGTGATTAAGGTCAATGGG - Intergenic
912733068 1:112126983-112127005 GCACTGTGATTAAGGTCAATGGG - Intergenic
912943499 1:114066051-114066073 GCCCTGTGATTAAGGTCAATGGG - Intergenic
913039194 1:115006543-115006565 GCCCTGTGATTAAGGTCAATGGG - Intergenic
913559414 1:120002429-120002451 GCCCTGTGATTAAGGTCAATGGG + Intronic
913638448 1:120788113-120788135 GCCCTGTGATTAAGGTCAATGGG - Intergenic
914280008 1:146161872-146161894 GCCCTGTGATTAAGGTCAATGGG + Intronic
914541048 1:148612790-148612812 GCCCTGTGATTAAGGTCAATGGG + Intronic
914625594 1:149458456-149458478 GCCCTGTGATTAAGGTCAATGGG - Intergenic
915667420 1:157457846-157457868 GCCCTGTGATTAAGGTCAATGGG - Intergenic
915709903 1:157885489-157885511 GCCCTGTGATTAAGGCCAACAGG + Intronic
916105936 1:161432447-161432469 GCCCTATGATTATAGTCAATGGG - Intergenic
916365854 1:164027029-164027051 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
916639427 1:166711140-166711162 TACCTGTGATTAAGGTGAATGGG - Intergenic
917216966 1:172689059-172689081 GCCCTGTGATTAAGGTCAATGGG - Intergenic
917462954 1:175248005-175248027 GCCCTGTGATTAAGGTCAGTGGG + Intergenic
917616934 1:176755441-176755463 GCCCCGTGATGAAGTTTAATGGG - Intronic
917764786 1:178203858-178203880 ACTCTGTGATTAAGGTCAATGGG + Intronic
918768712 1:188523703-188523725 GCCCTGTGATTAAGGTCAATGGG + Intergenic
918917985 1:190670034-190670056 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
919000488 1:191826027-191826049 GCCCTGTGAGTTACCTCAATGGG - Intergenic
919229986 1:194762147-194762169 GCCCTGTGATTAAAGTCAATGGG - Intergenic
919242056 1:194926370-194926392 GCCCTGTGATTAAGGTCAATGGG + Intergenic
919318219 1:196001196-196001218 GCCCTCTGATTAAGGTCAATGGG + Intergenic
919478834 1:198061845-198061867 GTCCTGTGACTAAGATCAATGGG - Intergenic
920197689 1:204240206-204240228 ATCCTGTGATTAAGGTCAATGGG + Intronic
921620006 1:217314893-217314915 GCCCTGTGGTTAAGGTCAATGGG + Intergenic
921986566 1:221318753-221318775 GTTCTGTGATTAAAGTCAATGGG + Intergenic
922006351 1:221534473-221534495 GGCCTGTGCTTCTGATCAATTGG + Intergenic
922780801 1:228250759-228250781 GCCCTGCGATTAAGGTCAATGGG - Intronic
923957499 1:239039505-239039527 GCCCTGTGGTTAAGGTCAATGGG + Intergenic
924840520 1:247705979-247706001 GCCCTGTGATTAATGTCAATGGG - Intergenic
924847218 1:247785735-247785757 GCCCTGTGATTAAGATCAATGGG - Intergenic
1063327177 10:5116092-5116114 GCTGTGTGATTAAGGTCAATGGG - Intronic
1063356549 10:5404843-5404865 GCCCTGTGATAAAGCTCAGCTGG - Intergenic
1063367801 10:5501608-5501630 GACCTGTGATTAAAATCCAAAGG + Intergenic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1064517335 10:16165933-16165955 GCCCTGCGATTAAAGTCAATGGG - Intergenic
1064543427 10:16427757-16427779 GCCCTGTGACTAAGAAGATTAGG - Intergenic
1066169795 10:32829163-32829185 GCCCTGTGATTAAGGTCAATGGG + Intronic
1066957870 10:42189896-42189918 GCACTCTGATTAAGGTAAATGGG + Intergenic
1067547297 10:47202625-47202647 GTCCTGTCATTATGATGAATTGG - Intergenic
1067754105 10:48991864-48991886 GCGCTGTGATTAAGATCAATGGG - Intergenic
1068007406 10:51407741-51407763 GCCCTGTGATTAAGGTCAATGGG - Intronic
1068470369 10:57454161-57454183 GCCCTTTGAATAAGATTAACTGG + Intergenic
1068836966 10:61566529-61566551 GCCATGTGATTAAGGTCAATGGG - Intergenic
1068909141 10:62359459-62359481 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1069146005 10:64892271-64892293 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1069192056 10:65504530-65504552 GCCCTGTGATTAAGGTCAATAGG - Intergenic
1069609407 10:69762626-69762648 GCCTTGTGATTAAGATCACCAGG - Intergenic
1069790569 10:71017732-71017754 GCCCTGTGATTAAGGTCGAAAGG - Intergenic
1070111731 10:73493790-73493812 GCCATTTGATTTAGATAAATAGG - Intronic
1071033000 10:81206620-81206642 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1071266822 10:83972153-83972175 ACCCTGTAATTAAGGTCAATGGG - Intergenic
1071308760 10:84323929-84323951 GCCCTATGATTAAGGTCAATGGG + Intergenic
1071364221 10:84882672-84882694 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1071378633 10:85035209-85035231 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1071673679 10:87635579-87635601 GCCCTGTGATTAAGATCAATGGG - Intergenic
1071937932 10:90551101-90551123 GTCCTGTGATTAAGGTTAATGGG + Intergenic
1071942527 10:90605932-90605954 GCCCTATGATTCAGGTCAATGGG - Intergenic
1072209009 10:93229851-93229873 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1073557610 10:104467743-104467765 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1073957513 10:108890374-108890396 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1073995628 10:109312938-109312960 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1074243950 10:111669136-111669158 ATGCTGTGATTAAGGTCAATGGG - Intergenic
1075607054 10:123819259-123819281 GCCCTGTGATTAGGGTCAATGGG + Intronic
1076123533 10:127955142-127955164 ACCCTGTGATTAAGGTCAATTGG + Intronic
1076772357 10:132672991-132673013 GCCTTGTGATTAAGGTCAACGGG - Intronic
1077401566 11:2360686-2360708 ACCCTGTGGTTAAGATCCCTGGG + Intergenic
1078430916 11:11287833-11287855 GCCCTGTGTTTGAGAACATTTGG - Intronic
1080019928 11:27549880-27549902 GTCCTGTGATTAAGGTCAATAGG - Intergenic
1080076853 11:28159345-28159367 GCCCTGTGATTAAGGTCAATGGG + Intronic
1081110777 11:39130566-39130588 GCCCTCTGATTAAGGTTAATGGG + Intergenic
1081609319 11:44549713-44549735 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1082836067 11:57650908-57650930 GCCCTGTGATTAAGGTCAATGGG + Intronic
1083093384 11:60222944-60222966 GCCCTATGATTAAGGTCAATGGG + Intronic
1083133994 11:60654572-60654594 GCCCCATGATTAAGGTCAATGGG + Intergenic
1085686219 11:78624011-78624033 TCCCTGTAATTAAGGTCAATGGG + Intergenic
1085937885 11:81171868-81171890 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1086141381 11:83504351-83504373 GCCCTGTGATTAAGGTCAGTGGG - Intronic
1086278858 11:85162265-85162287 GCCCTGTGATTAAGGTCAATGGG + Intronic
1086834371 11:91602216-91602238 GCCCTGTGATTAAGGGCAGTGGG + Intergenic
1087374269 11:97322389-97322411 GCTCTGTGATTAAGCTCAATGGG + Intergenic
1088097450 11:106116983-106117005 GACCTGTGATTAAGGTCAATGGG + Intergenic
1088191422 11:107232862-107232884 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1088388513 11:109287789-109287811 ACCATGTGATTAAGGTCAATGGG + Intergenic
1088407358 11:109496845-109496867 GCCCTGTGATTACGGTCAGTGGG - Intergenic
1088449590 11:109967133-109967155 ACCCTGTGATTAAGGTCAATGGG + Intergenic
1088836907 11:113585205-113585227 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1089903870 11:122015440-122015462 ACCCTGTGATTAAAGTCAATGGG + Intergenic
1090197022 11:124825500-124825522 ACCCTGTGATTAAGGTCAATGGG - Intergenic
1090221364 11:125029809-125029831 GCCCTGTGATTAAGGTCAATGGG - Intronic
1090918166 11:131185465-131185487 GCACAGTGATGAAGGTCAATGGG + Intergenic
1091051997 11:132380564-132380586 GCCTTGTGATTAAGGTCAATGGG + Intergenic
1091103719 11:132899023-132899045 GCCCCATGATCAAGGTCAATGGG + Intronic
1091898021 12:4120327-4120349 GCAATGTGATTAACATCCATTGG + Intergenic
1092093877 12:5825776-5825798 GCCCTGTGATTAAGGTCAATGGG + Intronic
1092381875 12:8003227-8003249 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1092922235 12:13242937-13242959 GCCCTGTGATTAAGGTAAATGGG - Intergenic
1093031555 12:14293791-14293813 GCCCTGTGATTAAGGTCAATCGG - Intergenic
1093036597 12:14337505-14337527 GCCCTGTGATTAAGATCAATTGG + Intergenic
1093048674 12:14483261-14483283 GCCCTGTGATTAAGGCCAATAGG - Intronic
1093049420 12:14489161-14489183 GCCCTGTGATTGAGGTCAACAGG - Intronic
1093509671 12:19911608-19911630 GCACTTTTATTAAAATCAATTGG + Intergenic
1093964798 12:25312765-25312787 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1093981217 12:25477727-25477749 GCCCTGTGATAAAGGTCAATGGG - Intronic
1093981364 12:25478970-25478992 GCCCTGTGATTAAGGTCAATGGG - Intronic
1095604149 12:44046466-44046488 GCCCTGTGATTAAGGTCAATGGG + Intronic
1095739068 12:45587403-45587425 GCTCTTTGATTAAGATCAATGGG + Intergenic
1095844144 12:46728158-46728180 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1095856002 12:46861860-46861882 GCCCCGTGATTAAGGTCAATGGG - Intergenic
1096289023 12:50325074-50325096 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1096457203 12:51797627-51797649 GCCCTGTGATTAAGGTCAATGGG - Intronic
1097077248 12:56404218-56404240 GCCCCATGATTAAAGTCAATGGG + Intergenic
1097437576 12:59570438-59570460 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1097554831 12:61123426-61123448 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1097564405 12:61250607-61250629 GCCTTGTGATTAAGGTCAATGGG - Intergenic
1097821096 12:64130091-64130113 GCTCTGTGATTAAGGTCAATGGG - Intronic
1098673273 12:73256070-73256092 ATTCTGTGATTAAGGTCAATGGG + Intergenic
1098716347 12:73831630-73831652 GCCCTGTGATTAAGGTCAGTGGG + Intergenic
1098731347 12:74039518-74039540 GTCCTATGATTAAGGTCAATGGG + Intergenic
1098736373 12:74110943-74110965 GCCCTGTGGTTAAGGTCAATGGG - Intergenic
1098750076 12:74281419-74281441 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1098776080 12:74619497-74619519 GTCCTGTGATTAAGGTCAATAGG + Intergenic
1098831627 12:75371892-75371914 TGCCTGTGATTAAGGTCAATGGG - Intronic
1099183128 12:79490625-79490647 GCTCTGTGATTAAGGTCAATGGG - Intergenic
1099366171 12:81767208-81767230 GCACTTTGATTAAGGTCAATGGG + Intergenic
1099379146 12:81934721-81934743 GCCCTGTGATTGAGGTCAATGGG - Intergenic
1099400999 12:82203937-82203959 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1099526603 12:83724910-83724932 ACCCTGTGATTAAGGTCAATGGG + Intergenic
1099632498 12:85168255-85168277 GCCCTGTGATTAAGGTCAGTAGG - Intronic
1099700638 12:86077734-86077756 GCCCTGTGATTAAGGTCAATGGG - Intronic
1099736074 12:86567548-86567570 GCCCTGTGATTAAGGTCAATGGG + Intronic
1100083550 12:90880024-90880046 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1100544861 12:95591798-95591820 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1101264389 12:103067948-103067970 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1101534358 12:105603929-105603951 GCCATGTGGTTAAGGTCAATGGG - Intergenic
1103035886 12:117655893-117655915 GCACTGTGATTAAGATCAATGGG + Intronic
1103396786 12:120613263-120613285 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1104148049 12:126054468-126054490 GCTCTGTGATTAAGGTCAACGGG + Intergenic
1104185163 12:126423555-126423577 GCCCTGTCATTAAGGTCATTGGG - Intergenic
1104533111 12:129591188-129591210 GCCCAGTGAGTCAGATCAAAAGG + Intronic
1105740419 13:23317293-23317315 GCCCTGTGATTAAGGTCAATGGG + Intronic
1106484280 13:30158790-30158812 GCCCTGTGGTTTATAACAATGGG - Intergenic
1107983330 13:45754139-45754161 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1108914064 13:55587081-55587103 GCCCTGTGATTAAGTTCAAGGGG - Intergenic
1109396691 13:61767345-61767367 GCCTTTTGACTAAGATCAAGTGG - Intergenic
1109516130 13:63444235-63444257 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1109519272 13:63486617-63486639 GCCCTGTGATTAAGGTCAATAGG + Intergenic
1109712441 13:66179039-66179061 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1109933101 13:69243355-69243377 GACCTGTAATTAAGATCAGTGGG - Intergenic
1109950777 13:69500391-69500413 GCCCTATGATTAAGGTCAATGGG - Intergenic
1110377407 13:74808342-74808364 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1110377526 13:74809485-74809507 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1110815821 13:79858977-79858999 ACCCTGTAATTAAGGTCAATGGG + Intergenic
1110833892 13:80062796-80062818 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1111057546 13:82971207-82971229 GCCCTGTGATTAACGTCAAAGGG - Intergenic
1111198779 13:84906712-84906734 GCCCTATGATTGAGATCAATGGG + Intergenic
1111208855 13:85050243-85050265 ACTCTGTGATTGAGATCAATGGG - Intergenic
1111317734 13:86583623-86583645 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1111363371 13:87207179-87207201 GCCCTGAGATTAAGGTCAATGGG - Intergenic
1111432036 13:88157978-88158000 GCCCTGTAACTCAGTTCAATGGG - Intergenic
1111535446 13:89596993-89597015 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1112230869 13:97588343-97588365 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1112832582 13:103471874-103471896 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1113319456 13:109219851-109219873 GACCTGTGATTAAGGTCACTAGG - Intergenic
1113396392 13:109951425-109951447 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1114905146 14:27118730-27118752 GCCCTGTGATTACGGTCAATGGG - Intergenic
1114911965 14:27211450-27211472 GACTTATGATTAAGATCTATTGG + Intergenic
1115059949 14:29175707-29175729 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1115130929 14:30051086-30051108 GCCCTGTGATTAAGGTCAATGGG + Intronic
1116158149 14:41234831-41234853 GCCCAGTGATTAAGGTCAAAGGG - Intergenic
1116249291 14:42459460-42459482 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1116415324 14:44671189-44671211 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1116531221 14:45976416-45976438 GCCCTATGATTAAGGTCAATGGG - Intergenic
1116729645 14:48605930-48605952 GTTCTGTGATTTAAATCAATAGG - Intergenic
1117217100 14:53561982-53562004 GCCCTGTTATTAAGGTTGATGGG + Intergenic
1117596020 14:57328052-57328074 GCCCTATGATTAAGGTCAATGGG - Intergenic
1117634378 14:57726202-57726224 GCCCTGGGATTAAGGTCAATGGG + Intronic
1118122182 14:62858359-62858381 GCCCTGTGATTAAGGTCAATGGG - Intronic
1118880606 14:69822829-69822851 GCCCTGTGATTCAGGTCAATGGG - Intergenic
1118950511 14:70432751-70432773 GCCCTGTGATTCAGGTCAATGGG - Intergenic
1119059455 14:71460370-71460392 GCCCTGTGATTAAGATCAATGGG - Intronic
1119107301 14:71937018-71937040 GCCCTGTGATTAAGGTCAACAGG - Intronic
1120081780 14:80225758-80225780 GCCCTGCAATTAAGGTCAATGGG - Intronic
1120250546 14:82057872-82057894 GTCCTATAATTAATATCAATGGG - Intergenic
1120350596 14:83352750-83352772 GACCTGTGAGTAAGGTCAATGGG + Intergenic
1120498163 14:85261770-85261792 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1120555775 14:85928821-85928843 GCCCTGTGATTAATGTTAATAGG - Intergenic
1120973947 14:90232633-90232655 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1121753814 14:96384635-96384657 GCCTTTTGCCTAAGATCAATTGG + Intronic
1122018131 14:98814343-98814365 GACCTGTGAATCAGGTCAATGGG - Intergenic
1123128371 14:105966030-105966052 GCCCTGTCATTAAGGTCAACGGG + Intergenic
1123142842 14:106097736-106097758 ACCATGGGATTAAGGTCAATGGG - Intergenic
1123190873 14:106568413-106568435 GCCATGGGATTAAGATCAATGGG - Intergenic
1123218444 14:106833930-106833952 GCCATGTGATTAAGGTCAATGGG - Intergenic
1202935241 14_KI270725v1_random:81880-81902 GCACTCTGATTAAGTTAAATGGG - Intergenic
1123408895 15:20042187-20042209 GCCCTGTCATTAAGGTCAATGGG + Intergenic
1123518226 15:21048897-21048919 GCCCTGTCATTAAGGTCAACGGG + Intergenic
1126283850 15:46988076-46988098 GCCCTGTGACTAAGGTCAATGGG + Intergenic
1126441695 15:48696742-48696764 GTGCTGTGATTACGATCAATTGG + Intergenic
1127357035 15:58210058-58210080 GCCCTGTGATTAAGGTCAATGGG + Intronic
1127486245 15:59420628-59420650 ACCCTGTCATTAAAATCATTGGG - Intronic
1128643060 15:69354063-69354085 GCTCTGTGATTAAGGTCAATGGG + Intronic
1130039532 15:80394506-80394528 GCCCTGTGAGTAGGATGACTGGG + Intronic
1131658946 15:94493114-94493136 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1132217861 15:100080449-100080471 GCCCTGTGACTAAGGTCAATGGG + Intronic
1133446667 16:5867084-5867106 GCCCTGTTAATAAGGTGAATAGG - Intergenic
1136871811 16:33813943-33813965 GCCCTGTCATTAAGATCAATGGG + Intergenic
1138560107 16:57796250-57796272 GCCCTGTGATAAGGATCAAATGG + Intronic
1138868629 16:60852622-60852644 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1141559280 16:84856211-84856233 GCCCTGTGATTAAGGTCAATGGG - Intronic
1203100361 16_KI270728v1_random:1302119-1302141 GCCCTGTCATTAAGATCAATGGG - Intergenic
1146238278 17:31188048-31188070 GCCCTGTGATTAAGGTAAATGGG + Intronic
1148635438 17:49145686-49145708 GCCCTGTGATTAAGGTCAATGGG - Intronic
1149255131 17:54817268-54817290 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1151037556 17:70819796-70819818 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1153089972 18:1331981-1332003 GCCCTGTGATTAAGGCCAATGGG + Intergenic
1153131021 18:1855901-1855923 GTGCTGTGATTAAGGTCAATGGG - Intergenic
1153217429 18:2833787-2833809 GCCCTATGATTAAGGTCAATGGG - Intergenic
1153684980 18:7536737-7536759 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1154068711 18:11132876-11132898 GCTCTGTGATTAAGGTCAATGGG + Intronic
1154252313 18:12754935-12754957 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1154505600 18:15037570-15037592 GCCCTGTGATTAAGGTTAATAGG + Intergenic
1156537871 18:37881087-37881109 GCCCTATGATTGAGGTCAATGGG + Intergenic
1156582637 18:38395084-38395106 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1156638614 18:39062627-39062649 GCCCTTCAATTAAGGTCAATGGG - Intergenic
1156990062 18:43398963-43398985 ACCCTGTGATTAAGGTCAATGGG - Intergenic
1157341462 18:46781830-46781852 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1157846270 18:51006794-51006816 GCCCTGTAATTAAGGTCAATGGG + Intronic
1158708074 18:59812020-59812042 GCCCTGGGATAATGATTAATAGG + Intergenic
1159151667 18:64530876-64530898 GCTCTGTGATTAAGATCAATGGG - Intergenic
1159558852 18:69973557-69973579 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1159706282 18:71692630-71692652 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
1159767839 18:72511022-72511044 GCCCTGTGATTAAGGTTAATGGG + Intergenic
1164392492 19:27837669-27837691 GAACTGTAATTAAGGTCAATGGG - Intergenic
1164472197 19:28545620-28545642 GGCCTGTGTTTAAGGTCCATGGG - Intergenic
1168539082 19:57195589-57195611 GCCCTGTGATTAAGGTCAATGGG - Intronic
925105301 2:1285877-1285899 GCCCTATGATTAAGGTCAATGGG - Intronic
925280207 2:2678672-2678694 GCCCTGTGATTAAGGTCAATGGG + Intergenic
925460988 2:4062269-4062291 GCCCTGTGATTAAGATCAATGGG + Intergenic
925772496 2:7297195-7297217 GCCCTGTGATTAAGATCAATGGG - Intergenic
926645533 2:15286540-15286562 GCCCTTTGATTAGGAACAAATGG - Intronic
926810145 2:16748887-16748909 GCCCTTTGATTAAGGTCAGTGGG - Intergenic
926827017 2:16915485-16915507 GTCCTGTGATTAAGGTCAATGGG + Intergenic
927008968 2:18881527-18881549 GCCCTTTGATTAAGGTCAATGGG + Intergenic
929189909 2:39130245-39130267 GCCCTGTGATTAAAGTCAATGGG + Intergenic
929269575 2:39958989-39959011 GCCCTGTGATTAAGGTCAATGGG - Intergenic
929386787 2:41417507-41417529 GTCCTGTGATTAAGGTCAATGGG - Intergenic
930294957 2:49543568-49543590 GCCCTGTGATTAACGTCAATGGG - Intergenic
930480921 2:51947443-51947465 GTTCTGTGATTAAGGTCAATGGG - Intergenic
930536373 2:52650440-52650462 GCCCTGTGATTAATGTCAACGGG - Intergenic
932870438 2:75393261-75393283 GCCCTGTGATTAAGGTCAATGGG - Intergenic
933344926 2:81071282-81071304 GCACTGTGATTGGGTTCAATTGG - Intergenic
933394224 2:81711536-81711558 GCCCTGTGATTAAGATTAATGGG - Intergenic
934465651 2:94260909-94260931 GCACTCTGATTAAGGTAAATGGG - Intergenic
935184192 2:100716694-100716716 GCCCCATGATTAAGGTCAATGGG + Intergenic
935424867 2:102909616-102909638 GCCCTGTGATTAAGGTCAATGGG - Intergenic
935527070 2:104183204-104183226 GCCCTGTGATTAAGGTCAATGGG + Intergenic
935564053 2:104588434-104588456 GCCCTGTGATTAAGGTCAATGGG - Intergenic
935823441 2:106916984-106917006 GCCTTGTGATTAAAATCAGTAGG + Intergenic
936610315 2:113996181-113996203 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
936641459 2:114316516-114316538 GCCCTGTGATTAAGGTCAATGGG + Intergenic
936646137 2:114375157-114375179 ACTCTGTGATTAAGGTCAATGGG - Intergenic
937581830 2:123497316-123497338 GTTCTGTGATTAAGGTCAACAGG - Intergenic
937765877 2:125659815-125659837 ACCCTGTGATTAAGGTCAAGGGG + Intergenic
937784962 2:125885908-125885930 GCTCTGTCATTAAGGTCAATTGG - Intergenic
937800907 2:126079125-126079147 GCCCTGTGATTAAGGTCAATGGG + Intergenic
937802581 2:126097377-126097399 GCCCTGTGGTTAAAGTCAATGGG + Intergenic
937852327 2:126646931-126646953 GCCCTGTGATCAAGGTCAATGGG - Intergenic
938204133 2:129402746-129402768 GCCCTGTGATTAAAGTCAATAGG + Intergenic
938504789 2:131867838-131867860 GCCCTGTGATTAAGGTTAATAGG + Intergenic
939138951 2:138330620-138330642 GGCCTGTGATAAAGATCAGTAGG - Intergenic
939214115 2:139214063-139214085 GCCCTGTGATTAAGGTCAATGGG + Intergenic
939276282 2:140001534-140001556 CTCCTGTTATTAAGATCAATGGG + Intergenic
939788431 2:146544289-146544311 GCCTTGTGATTAAGGTCAATGGG - Intergenic
940171068 2:150830877-150830899 GCCCTGTGATTAAGGTCAATGGG - Intergenic
940343948 2:152610357-152610379 GCCCTGTGAATAGGCTAAATAGG - Intronic
940471839 2:154111298-154111320 GCCCTGTGATTAAGGTCAATGGG - Intronic
940676748 2:156732727-156732749 TCTCTATGATTAAGTTCAATGGG + Intergenic
941330416 2:164172743-164172765 GCCCTGTGATTAAGGTCAATGGG - Intergenic
941387038 2:164866425-164866447 GCCCTGTGATTAAGGTCAATGGG + Intergenic
941668278 2:168262915-168262937 TCCCTGCAATTAAGGTCAATGGG + Intergenic
942322185 2:174745363-174745385 ACCCTGTGATTAAGGTCAATGGG + Intergenic
942988094 2:182165549-182165571 GTCCTGTGATGAAGGTCAATGGG + Intronic
943021135 2:182575215-182575237 ACTCTGTGATTAAGGTCAATGGG - Intergenic
943182527 2:184561465-184561487 GCCCTGTGATTAATGTCAATAGG + Intergenic
943239028 2:185361165-185361187 GCCCTGTAATTAAGGTCAATGGG - Intergenic
943317685 2:186410504-186410526 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
943383823 2:187179269-187179291 GCCCTGTGATTAGGGTCAATGGG - Intergenic
943385652 2:187201426-187201448 GCCCTGTGATTAAGGTAAATGGG - Intergenic
943517341 2:188905432-188905454 GTCCTGTGATTAAGATCAATGGG - Intergenic
943833366 2:192489306-192489328 GCCCTATGATTAAGGTCAATGGG - Intergenic
944090174 2:195899600-195899622 CCTATGTGATTAAGAACAATAGG - Intronic
945642435 2:212445662-212445684 GCCCTATGATTGGGGTCAATGGG + Intronic
945717590 2:213378848-213378870 GCCCTGTGATTAAGGTCATTGGG - Intronic
945725605 2:213469677-213469699 GCCCTGTGATTAATGTCAATGGG - Intronic
946533865 2:220606064-220606086 GCCCTGTGATTAAGATCAATGGG - Intergenic
946703511 2:222435985-222436007 TCCCTGTGATTAAGGTCAATGGG - Intronic
947281771 2:228463186-228463208 GTCCTGTGATTAAGGTCAAAGGG - Intergenic
947441101 2:230122077-230122099 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1169626620 20:7578507-7578529 GCCCTATGATTAAGGTCAATGGG - Intergenic
1170470375 20:16662615-16662637 GCCCTATTATTAATATCAGTTGG - Intergenic
1170990176 20:21294040-21294062 GCCCTGCGCTTAGGAACAATGGG + Intergenic
1172374601 20:34427282-34427304 TTACTGTGATTAAAATCAATGGG + Intronic
1173396912 20:42688590-42688612 GGACTGTGATTTATATCAATAGG + Intronic
1173983551 20:47243321-47243343 GCTCTGAATTTAAGATCAATTGG + Intronic
1176596658 21:8704116-8704138 GCACTCTGATTAAGGTAAATGGG - Intergenic
1176792260 21:13331548-13331570 GCCCTGTGATTAAGGTTAATAGG - Intergenic
1177139172 21:17340442-17340464 GTCCTGTGATTAATGTCAATGGG - Intergenic
1177267961 21:18808761-18808783 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1177414003 21:20770996-20771018 GCCCTGAGTTTGAGATAAATTGG - Intergenic
1177505313 21:22012401-22012423 GTCCTGTGATTAAGGTCCATGGG - Intergenic
1177940909 21:27410575-27410597 GCCGTGTGATTAAGGTCAATGGG - Intergenic
1177991658 21:28042410-28042432 GCCCTGTGATTAAGGTTAATAGG - Intergenic
1178005794 21:28218613-28218635 GCCCTGTGATTAAAGTCAGTGGG - Intergenic
1178061937 21:28862182-28862204 GCCCTGTGATTAAGGTCAGTAGG + Intergenic
1179414887 21:41190712-41190734 GCCCTGTGATTAAGATCAATGGG - Intronic
1180279579 22:10681558-10681580 GCACTCTGATTAAGGTAAATGGG - Intergenic
1180586791 22:16900088-16900110 GCACTCTGATTAAGGTAAATGGG - Intergenic
1180590894 22:16936544-16936566 GCACTCTGATTAAGGTCAATGGG - Intergenic
1181367068 22:22386075-22386097 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1182765840 22:32757767-32757789 GCCCTGTGATTAAGGTCAATGGG + Intronic
1182965929 22:34520900-34520922 GCCCTGTAATTAAGGTCAATGGG + Intergenic
1184603301 22:45556540-45556562 GCCCTGTGATTAAGGTCAATGGG - Intronic
1184938849 22:47746029-47746051 GCCCTGTGATTAAGGTCAACAGG - Intergenic
949125408 3:441269-441291 GCCCTGTGATTAAGGTCAATGGG - Intergenic
949169779 3:984785-984807 GCCCTCTGATTAAGGTCAATGGG - Intergenic
949445862 3:4132883-4132905 GCCCTGTGATTAAGGTCAATAGG + Intronic
949639153 3:6015344-6015366 GCCCTGTGAGTAAGGTCAGTGGG + Intergenic
950358136 3:12428973-12428995 GCAAACTGATTAAGATCAATGGG - Intronic
951003813 3:17594310-17594332 GCCTTGTGATTAAGGTCAATGGG + Intronic
951086796 3:18521097-18521119 TGCCTGTGATTAAAGTCAATGGG + Intergenic
951105447 3:18736702-18736724 GCCATTTCATTGAGATCAATGGG - Intergenic
951291105 3:20873227-20873249 GCCCTGTGATTAAGGTCAATGGG - Intergenic
951384770 3:22029340-22029362 GCCCTGTGATTAAGGTCAATGGG + Intronic
952313155 3:32208818-32208840 GTCCTGTGATTAAGGTCAATGGG - Intergenic
954511245 3:51127866-51127888 GCCCTGTGATTAAGGTCAATGGG - Intronic
956307111 3:67837451-67837473 GCCCTGTGATTAAGGTCAATTGG + Intergenic
956360359 3:68440708-68440730 TCCCTGTGACTAAGGTCAATGGG - Intronic
956509921 3:69982174-69982196 GTCCTCTGATTAAGGCCAATGGG + Intergenic
956703649 3:71981077-71981099 GCCCTGTGACTAAGGTCAATGGG - Intergenic
957634467 3:82762245-82762267 GCTCTGTGACTAAGTTCAATGGG + Intergenic
957689820 3:83553439-83553461 GCCCTGTGATTAAGGTCAATGGG - Intergenic
957754829 3:84471252-84471274 GCCCTGTGATTAAGGTCAATGGG + Intergenic
958258771 3:91354916-91354938 GCCCTGTGATTAAGGTCAATGGG - Intergenic
958499641 3:94888713-94888735 GCCCTGTAATTAAGGTCAGTGGG + Intergenic
958715350 3:97773993-97774015 GCCCTGTGATTAAGGTCAATGGG - Intronic
958845534 3:99260599-99260621 GCCCTGTGATTAAGGTCAATGGG - Intergenic
958934555 3:100242431-100242453 GCCCTGTGATTAAGGTCAATGGG + Intergenic
959226538 3:103595461-103595483 GCCCTGTGATTAAGGTCAATGGG - Intergenic
959289191 3:104450769-104450791 GCCCTGTGATTAAGGTCAATGGG - Intergenic
959998121 3:112700114-112700136 GCCCTGTGATTAAGATCAATGGG + Intergenic
960494501 3:118358938-118358960 GGCCTGTGATTAGGGTCAATGGG - Intergenic
961263104 3:125618214-125618236 GCCCTGTGATTAAGGTCAACGGG + Intergenic
961710728 3:128826197-128826219 GCCCTGTGATTAAGGTCAATGGG - Intergenic
962214957 3:133513197-133513219 GCCCTGTGGTTAAGGTCAATGGG + Intergenic
963331564 3:143921577-143921599 GCCCTGTGATTAAAGTAAATGGG - Intergenic
963355407 3:144205035-144205057 GCCCTGTATTTAAGGTCAGTGGG - Intergenic
963378996 3:144505460-144505482 GCCCTGTGATTAAGGTCAATGGG - Intergenic
963453763 3:145517524-145517546 GCCCTATGATTAAGGTCAATGGG - Intergenic
963970064 3:151420135-151420157 GCCCTGTGATTAAGGTCAATGGG - Intronic
964146756 3:153473159-153473181 GCCCTGTGATTAAGGTCAATGGG + Intergenic
964383254 3:156119756-156119778 GCCCTATGGTTAAGATGCATGGG - Intronic
964678987 3:159317096-159317118 GCTCTGTGATTAAGGTCAATGGG - Intronic
964756751 3:160095875-160095897 GCCATGTGAGTAAGAACAAAAGG - Intergenic
965034757 3:163424114-163424136 GCCCTGTGATTAAGGTCAATGGG - Intergenic
965071246 3:163917490-163917512 GCCCTGTAATTAAGGTCAATGGG + Intergenic
965154947 3:165039257-165039279 GCCCTTTGATTATTATCTATAGG - Intronic
965226513 3:165998954-165998976 GCCCTATGATTAAGGTCAATGGG - Intergenic
965291511 3:166887765-166887787 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
965958175 3:174396698-174396720 GCCATGTGATTAAGGTAAATGGG + Intergenic
965995971 3:174883850-174883872 GCCCTATGTTTAAGGTCAATGGG - Intronic
966044085 3:175529086-175529108 GCCCTGTGATTAAGGTCAATGGG - Intronic
966340403 3:178919316-178919338 TCAATGTTATTAAGATCAATTGG - Intergenic
966445938 3:180000393-180000415 GCCCTGTGATTAAGGTCAATGGG + Intronic
967832042 3:193927809-193927831 CCTCTGTGATTAAGGTCAATAGG + Intergenic
968800493 4:2740266-2740288 GCCCTGTGATTAAGGTCAATGGG + Intergenic
968907266 4:3460234-3460256 GCCCTGTGATTAAGGTCAATGGG + Intergenic
970629538 4:17925327-17925349 GCCCTGTGATTAAGGTCAATGGG + Intronic
970729745 4:19088848-19088870 GCTCTGTGATTAAGGTCAATGGG + Intergenic
971687137 4:29785270-29785292 GCCCTGTGATTAAGGTCAATGGG - Intergenic
971979060 4:33731050-33731072 GCCCTGTGATTAAGGTCAATGGG - Intergenic
972085457 4:35208907-35208929 GCCCTGTGATTAAAGTCAATGGG + Intergenic
972095739 4:35344621-35344643 TCCCTGAGATGAAGGTCAATGGG + Intergenic
972192687 4:36613585-36613607 GCCCTGTGATTAAGGCTAATGGG + Intergenic
972201055 4:36715385-36715407 GCCCTATGTTTAAGGTCAATGGG - Intergenic
972806180 4:42531195-42531217 GCCCTGTGATTAAGGTCAATGGG + Intronic
972882733 4:43446348-43446370 ACTCTGCGATTAAGGTCAATGGG - Intergenic
973092827 4:46158905-46158927 ACCCTGTGATTAGGGTCAGTGGG + Intergenic
973103156 4:46296555-46296577 GCCCTGTGATTAAGGTCAATGGG + Intronic
973129938 4:46637904-46637926 GCCCTGTGATTAAGGTCAATGGG - Intergenic
973164016 4:47054479-47054501 GGACTGCGATGAAGATCAATGGG + Intronic
974443844 4:61953707-61953729 GCCCTGTGATTTAGAGACATAGG + Intronic
974459255 4:62166075-62166097 GCCCTGTGATTAAGGTCAATGGG + Intergenic
974478799 4:62419000-62419022 GCTCTGTGATTAAGGTCAATGGG - Intergenic
974727514 4:65814671-65814693 GCCCTGTGATTAAGGTCATTGGG + Intergenic
974746731 4:66087468-66087490 GCCCAGTGACTAAGGTCAATGGG - Intergenic
975024746 4:69534039-69534061 GCCCTTTGATTAAGATCAGTGGG + Intergenic
975386479 4:73765691-73765713 GCCCTATGATAAAGGTCAATGGG - Intergenic
975742417 4:77442485-77442507 GCCCTATGATTAAGTTCAATGGG + Intergenic
975982367 4:80175452-80175474 GCCCTGTGATTAAGGTCAATGGG - Intergenic
976033964 4:80794021-80794043 GCCCTGTGATTAATGTCAATGGG - Intronic
976301061 4:83516010-83516032 ACCCTGTGATTAAGGTCAATGGG - Intronic
976324151 4:83751688-83751710 GCCTTGTGATTAAGATCAATGGG + Intergenic
977031930 4:91893983-91894005 GCCCTGTGATTAAGGTTAATGGG + Intergenic
977431012 4:96930016-96930038 GCCCTGTGATTAAGGTCAATGGG + Intergenic
977489847 4:97698256-97698278 GCCCTGTGATTAAGCTTAATGGG - Intronic
977701498 4:100028075-100028097 GCTTTGTGATTAAGGTCAATGGG - Intergenic
977832982 4:101616048-101616070 GCCCTGTGATAAAGGTCAATGGG - Intronic
977846894 4:101777463-101777485 GCCCCATGATTAAGGTTAATAGG - Intronic
977898952 4:102396409-102396431 GCTCTGTGATTAAGGTCAATGGG + Intronic
977930156 4:102741998-102742020 GCCCTGAGATTAAGGTCAATGGG - Intronic
978341325 4:107723728-107723750 ACCCTGTGATTAAGGTCAATGGG - Intergenic
978771900 4:112465963-112465985 GCCCTGTGATTAAGGTCAATGGG - Intergenic
978898815 4:113925017-113925039 GCCCTGTGATTAAGGTCAATGGG - Intronic
979051908 4:115945388-115945410 GCCCTGTCATTATGGTCAATGGG + Intergenic
979075632 4:116265850-116265872 GCCCTGTTATTAAGGTCAATGGG + Intergenic
979138793 4:117146603-117146625 TCCCTGTGATAAAGGTCAATGGG + Intergenic
979507319 4:121513477-121513499 GCCCTGTGATTAAGGTCAATGGG - Intergenic
979767221 4:124476112-124476134 GCTCTGTGATTAAGGTCAATGGG + Intergenic
979888336 4:126060355-126060377 GCCCTGTAATTAAAGTCAATGGG - Intergenic
979898175 4:126187249-126187271 CCCCTGTGATTAAAGTCAATGGG - Intergenic
980385556 4:132085230-132085252 GCCCCGTGATTAAGGTCAATGGG - Intergenic
980405652 4:132351970-132351992 GCCCTGTGATTAACATCAATGGG - Intergenic
980513711 4:133825725-133825747 GCCCTGTGATTAAGGTCAATGGG + Intergenic
980602460 4:135041828-135041850 GTCCTGTGATTAAGGTCAATGGG + Intergenic
980629760 4:135416089-135416111 GCCCTTTGATTAAGGTCGATGGG + Intergenic
980958040 4:139448133-139448155 GCCCTGTGGTTGAAGTCAATGGG + Intergenic
981383371 4:144098982-144099004 GAACTATAATTAAGATCAATGGG + Intergenic
981452654 4:144916402-144916424 GCCCTGTGATTAAGATCAATGGG - Intergenic
981463054 4:145033600-145033622 GCCCTGTGATTAAGGTCAATGGG + Intronic
981605616 4:146537277-146537299 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
981835250 4:149045725-149045747 ACCTTGTGATTAAGGTCAATAGG + Intergenic
981873784 4:149517014-149517036 GACCTGTGATTAAGGTCAATGGG + Intergenic
982369083 4:154613528-154613550 GCCCAGTGATAAATCTCAATAGG - Intergenic
982481939 4:155922570-155922592 GCCCTGTGATTAATGTCAATGGG - Intergenic
982597532 4:157405229-157405251 GCCCTGTGCTTAAGGTCAATGGG - Intergenic
982623088 4:157731068-157731090 GCCCAGTGATTAAGGTCAATGGG - Intergenic
982835788 4:160118441-160118463 GCGCTATAATTAAGGTCAATAGG + Intergenic
982848034 4:160276145-160276167 GCCCTGTGATTAATGTCAATGGG + Intergenic
983027651 4:162757107-162757129 GCCCTGTGATTAAGGTCAATGGG + Intergenic
983582944 4:169326670-169326692 GACCTGTGATTAAGATTAATGGG + Intergenic
984060037 4:174980215-174980237 GCTCTGTGATTAAGGTAAATGGG - Intergenic
984617097 4:181911013-181911035 ACTCTGTGATTAGGATCAAAAGG + Intergenic
985076412 4:186219811-186219833 GCCCTGTGATTAAGGTCAATGGG - Intronic
985832566 5:2245141-2245163 GCCCTATGATTAAGGTCAATGGG + Intergenic
985953651 5:3243658-3243680 GCCCTGTAATTAAGGTCAATTGG - Intergenic
986261388 5:6150704-6150726 GCCCTGTGATTAAGGTCAATGGG - Intergenic
986525370 5:8668392-8668414 GCTCTGTGATTAAGGTCAATGGG + Intergenic
986960080 5:13200997-13201019 GTCCTGTGATTAAGGTCAACGGG + Intergenic
987153435 5:15063479-15063501 GCCCTGTGATTAAGGTCAATGGG + Intergenic
987468001 5:18295539-18295561 GCCCTGTGATCAAGATCAATGGG - Intergenic
987504635 5:18751656-18751678 GCCCTGTGATTAAGGTCAATGGG + Intergenic
987737069 5:21859914-21859936 GGCCTGTGATTAACATCAATGGG + Intronic
987737951 5:21869259-21869281 GCCCTATGATTAAGGTCAATGGG + Intronic
987955908 5:24739669-24739691 TCCCTGTGATAAAGACCAGTAGG - Intergenic
987960732 5:24804854-24804876 GCCTTATGATTAAGTTCAGTTGG + Intergenic
988056524 5:26104849-26104871 GCCCTGTGATTAAAGTCAATGGG - Intergenic
988079575 5:26399594-26399616 GTTCTGTGATTAAGGTCAATGGG - Intergenic
988092670 5:26563115-26563137 GACCTGTGTTTAAGGGCAATGGG + Intergenic
988160577 5:27515049-27515071 GCCCTGTGATTAAGATCAATGGG - Intergenic
988168969 5:27631027-27631049 GTCCTGTGATTAAGGTCAATGGG - Intergenic
988189020 5:27903061-27903083 GCCCCATGACTAATATCAATGGG + Intergenic
988205055 5:28123529-28123551 GCCCTGTGATTATGGTCAATGGG - Intergenic
988228996 5:28449941-28449963 GCCCTGTGATTAAGGCCAATGGG + Intergenic
988258454 5:28850791-28850813 GCTGTGTGATTAAGGTCAATGGG + Intergenic
988562383 5:32292656-32292678 GCCCTGCAATTAAGGTCAATGGG + Intronic
988785283 5:34561134-34561156 GCCCTGTGATTAAGGTCAATGGG - Intergenic
989307254 5:39972800-39972822 GACCTGTGATTAAGGTCAATAGG - Intergenic
989457396 5:41659941-41659963 GCCCTGTGAGTAAGGTCAGTGGG - Intergenic
989486136 5:41994567-41994589 GCCCTATGATTAAGGTCAAAGGG - Intergenic
990990929 5:61683267-61683289 GTGCTCTGATTATGATCAATAGG - Intronic
991013539 5:61909071-61909093 GTCCTGTGATTAAGGTCAATAGG - Intergenic
991033805 5:62107741-62107763 GTCCTGTGATTGAGGGCAATGGG + Intergenic
991262779 5:64685011-64685033 GGCCTGTGACTAAGATAAAAAGG - Intergenic
991330496 5:65487873-65487895 GCCCAGTGATTAAGGTCAATGGG - Intergenic
991946397 5:71901945-71901967 GCCCTGTGATTAAGGTCAATGGG + Intergenic
992243208 5:74791677-74791699 GCCCTGTGATTAAGGTCAATGGG + Intronic
993203643 5:84849363-84849385 GCCCTGTGATTAAGGTCAATGGG + Intergenic
993231663 5:85245727-85245749 GCTCTGTGATTAAGGTCAATGGG - Intergenic
993321021 5:86467254-86467276 CCCCTGTGATTAAGGTCAATGGG + Intergenic
993367092 5:87048042-87048064 GCCCTGTGTTTAAGGTCAACGGG - Intergenic
993412334 5:87589995-87590017 GCCTTGTGATTAAGGTCAGTGGG - Intergenic
993427469 5:87785751-87785773 GCTATGTGATACAGATCAATAGG - Intergenic
993792024 5:92220725-92220747 GCTCTGTGATTAAGGTCAACGGG + Intergenic
994291124 5:98030136-98030158 GCCCTGTGATTAAGATCAATGGG - Intergenic
994604992 5:101955644-101955666 GCCCTATGATTAAGGTCAATGGG - Intergenic
994917187 5:105995294-105995316 GCCCTGTGATTATGGTCAATGGG + Intergenic
994984167 5:106913917-106913939 GCCCTGTGATTAAGGTCAATGGG - Intergenic
995095573 5:108231871-108231893 GCCCTGTGATTAAGGTCGATGGG + Intronic
995427433 5:112041626-112041648 GTCCTGTGATTAAAGTCAATGGG - Intergenic
995483422 5:112615014-112615036 GCCCTGTGATTAAGGTCCATGGG - Intergenic
995776025 5:115725889-115725911 GCCCTGTGATTAAGGTCAATGGG - Intergenic
996018817 5:118569694-118569716 AACCTGTGATTAAGGTCAATGGG + Intergenic
996164677 5:120210412-120210434 GCCCTGTGACTAAGGTCAATGGG - Intergenic
996825813 5:127679639-127679661 ACCCTGTGATTAAGGTAAATGGG + Intergenic
999351622 5:150876634-150876656 GCCCTGTGATGAGGGTCATTGGG + Intronic
1000417266 5:160996024-160996046 GCTTTGTGATTAAGGTCAATGGG + Intergenic
1000499359 5:162029815-162029837 GCCCTGAGATTAAGGTCAATGGG + Intergenic
1000730676 5:164830096-164830118 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1001173767 5:169445757-169445779 GGCCTTTGATTAAGGTCAATAGG + Intergenic
1002998226 6:2306587-2306609 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1003695645 6:8404347-8404369 CCCCTGTGATTAAAGTCAATGGG - Intergenic
1003758855 6:9151910-9151932 GCCCTGTGATTAAGATCTATGGG + Intergenic
1004166071 6:13257551-13257573 GAGCTGTGATTTAGACCAATGGG - Intronic
1005185415 6:23158882-23158904 CCCCTGTGATTAAGGTCAATGGG + Intergenic
1006001795 6:30970888-30970910 GCCCTGTGATTAAGGTCAGTGGG + Intergenic
1006062584 6:31435017-31435039 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1006751141 6:36378046-36378068 GCCATGTAACTAAGATCAAATGG + Intronic
1008079134 6:47176747-47176769 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1008158218 6:48044022-48044044 GTCCTGTAATGAGGATCAATTGG - Intronic
1008340501 6:50358099-50358121 GCCCTGTGGTTAAGGTCAATGGG + Intergenic
1008820633 6:55626948-55626970 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1008996485 6:57665658-57665680 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1009185000 6:60564448-60564470 GCCCTGTGATTAAGGCCAATGGG + Intergenic
1009348822 6:62649255-62649277 ATCCTGTGATTAAGGTCAATGGG + Intergenic
1009770122 6:68135031-68135053 ACCCTGTGATTCAGGTCAACGGG - Intergenic
1009806729 6:68608768-68608790 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1010323816 6:74542308-74542330 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1010552403 6:77238671-77238693 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1010580570 6:77592430-77592452 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1010818874 6:80390224-80390246 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1011039105 6:83011486-83011508 GCCCTGTGATTAAGGTCAATGGG - Intronic
1011830291 6:91363744-91363766 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1012002178 6:93666725-93666747 GCCCTGTAGTTAAGGTCAGTGGG + Intergenic
1012821030 6:104084585-104084607 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1012920532 6:105217732-105217754 GCCCTATGATTAAGGTCAATGGG - Intergenic
1013406914 6:109851560-109851582 GCACTATGATTAAGGTCAATGGG + Intergenic
1013623743 6:111917124-111917146 GCCCTGTGATTAAGGTTAATGGG - Intergenic
1014414948 6:121172449-121172471 GCCCTGTGATTAAGATCAATGGG + Intronic
1014417238 6:121197233-121197255 GCCCTGTGATTAAGGTCAATGGG + Intronic
1014455967 6:121635346-121635368 GTCCTGTGATTAAGGTTGATGGG + Intergenic
1014533946 6:122594782-122594804 GCCCTGCTATTAAGGTCAATGGG - Intronic
1015095196 6:129407795-129407817 CCTCTGTGTTTAAGGTCAATGGG - Intronic
1015443030 6:133270724-133270746 GCCCTATGATTAAGGTCAATGGG - Intronic
1015476008 6:133659313-133659335 ACCCTGTGAATAAGGTCAATGGG + Intergenic
1016119699 6:140330862-140330884 GCCCTGTGATTAAAGTCAATGGG - Intergenic
1016147077 6:140690885-140690907 GCCTTGTGATTAAGGTCAATGGG - Intergenic
1016419419 6:143869186-143869208 GTCCTGTGATTCAGGTCAATGGG - Intronic
1016576017 6:145570764-145570786 GCCCTGTGATTAAGGTCAATGGG - Intronic
1016594769 6:145786967-145786989 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1016594896 6:145787993-145788015 ACCCTGTGATTAAGGTCAGTGGG + Intergenic
1017452581 6:154567509-154567531 ATCCTGTGATTAAGTTCAACAGG + Intergenic
1018183762 6:161246933-161246955 GCCCTGTGTTTAATGTTAATGGG - Intronic
1018534783 6:164808589-164808611 GCCCTGTGATTAAGGTCCATGGG - Intergenic
1018600129 6:165529320-165529342 GCCCTGTGATTAAAGTCTATGGG + Intronic
1018780879 6:167064219-167064241 GCCCTATGATTAAGGTCAATGGG - Intergenic
1020567526 7:9817034-9817056 GCCCTGTAGTTAAGGTCAATGGG - Intergenic
1020710556 7:11599095-11599117 GCCCTGTGATTAAGGTCAATAGG + Intronic
1020710570 7:11599194-11599216 GCCCTGTGATTAAGGTCAATGGG + Intronic
1020870926 7:13628073-13628095 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
1021304895 7:19020819-19020841 GCCCTGTGATTAAGATCGATGGG - Intergenic
1021362583 7:19734023-19734045 ACCCTGTGATGAAGATGAACAGG + Intronic
1021989069 7:26124742-26124764 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1022079141 7:27002157-27002179 GCCCTGTGATTAAGATCAATGGG + Intergenic
1024040792 7:45551970-45551992 GCCCTGTGGTTAAGGTCAATGGG + Intergenic
1024283007 7:47734983-47735005 GCACTGTGTTTAAGATGCATTGG - Intronic
1024744459 7:52390249-52390271 GCCTTGTGATTAAGGTCAATGGG + Intergenic
1024866346 7:53908167-53908189 GCCCTGTGATTAAGGTTAATGGG + Intergenic
1024884113 7:54122838-54122860 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1026046237 7:66907331-66907353 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1027406809 7:77871216-77871238 GCCGTGTGATTAAGGTCAATGGG - Intronic
1027474240 7:78609716-78609738 GCTCTGTGATTAAGGTCAATGGG - Intronic
1027610313 7:80352105-80352127 GCCATATGATTAAGGTCAAAGGG - Intergenic
1027686048 7:81279771-81279793 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1028044081 7:86093279-86093301 GTCCTGTGATTAAGGTCAATAGG + Intergenic
1028141980 7:87283839-87283861 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1028935265 7:96456885-96456907 GTCTTGTGATTAAGGTCAACGGG + Intergenic
1030277797 7:107738457-107738479 GCCCTGTGATTAAGATTAACAGG + Intergenic
1030355665 7:108539347-108539369 GCCCTGTGATTAAGGTCAATGGG + Intronic
1030369009 7:108675865-108675887 GCCCCGTGATTAAGATCAATGGG + Intergenic
1030457215 7:109791216-109791238 GCCCTGTGATTAAAGTCAGTGGG - Intergenic
1030506938 7:110436500-110436522 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1030579269 7:111332997-111333019 GCCCTCTGATTAAGGTCAATGGG + Intronic
1030883036 7:114904720-114904742 GTCCTATGATTAAGGTCAATGGG - Intergenic
1030931043 7:115523849-115523871 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1031015520 7:116571783-116571805 GCACTTTGATTAATATAAATTGG + Intergenic
1031474207 7:122203535-122203557 GCCCTGTGATGAAGGTCAATGGG - Intergenic
1031682256 7:124689073-124689095 GCCCTGTGATTAAGTTCAATGGG + Intergenic
1031768010 7:125805501-125805523 GCGCTGTGATTAAGGTCAATGGG + Intergenic
1031833256 7:126651840-126651862 GCCCTGTGATTCAGGTCAATGGG + Intronic
1031861270 7:126982911-126982933 GCCCTGTGATTAAGGTCAATGGG - Intronic
1031861388 7:126983717-126983739 GCCCTCTGATTAAGGTTAATGGG + Intronic
1032152845 7:129445152-129445174 GCCCTGTGATTAAGGTCGATGGG - Intronic
1033076510 7:138254838-138254860 GCCCTGTGATAAAGGTCAATGGG + Intergenic
1034170173 7:149056720-149056742 GCCCTGTGATTAAGGTCTACCGG + Intergenic
1036592890 8:10184985-10185007 GCCCTGCAATAAAGATCAAAAGG - Intronic
1037675475 8:21047381-21047403 GCCCTGTTATTAAGGTCAACAGG - Intergenic
1039323939 8:36464728-36464750 ACCCTGTGATTAAGGTAAATGGG - Intergenic
1039857867 8:41431925-41431947 ACCCTGTGATTAAGGTCAGTGGG + Intergenic
1040912182 8:52530233-52530255 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1041935550 8:63327819-63327841 GCCTTGTGATTAAAGTCAGTGGG + Intergenic
1041938677 8:63362916-63362938 TCCCTGTGATTACCATCAGTAGG + Intergenic
1042000812 8:64122176-64122198 GCCCTGTTATTAAGGTCAATGGG - Intergenic
1043105478 8:76104605-76104627 GCCTTGTGACTACGGTCAATGGG - Intergenic
1043141548 8:76596063-76596085 GACCTGTGACTAAAATCAAATGG + Intergenic
1043258260 8:78161989-78162011 TCCCTGTGATTAAGGTCAATGGG + Intergenic
1044071710 8:87768704-87768726 GCCCTGAGTTAAATATCAATTGG - Intergenic
1044151038 8:88774894-88774916 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1044285722 8:90410630-90410652 GCCCTGTGATTAAGATCAATGGG - Intergenic
1044486920 8:92765360-92765382 GCCTTGTGATAAAGGTCAATGGG - Intergenic
1044895822 8:96890500-96890522 GCCTTGTGATTATGGTCAATGGG - Intronic
1045222023 8:100208382-100208404 GCCCTCTGATTAAGGTCAATGGG + Intronic
1046197808 8:110886028-110886050 ACCCTGTAATTAAAGTCAATGGG + Intergenic
1046417361 8:113935363-113935385 GCACTGTGATTAAGGTCAATGGG - Intergenic
1047453856 8:124991101-124991123 GCCTTATGATTAAGGTCAATGGG + Intergenic
1048000177 8:130373254-130373276 CACCTGTGATTAAAATCCATAGG - Intronic
1049538769 8:143195951-143195973 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1050053135 9:1623725-1623747 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1050902082 9:10961734-10961756 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1051882204 9:21851091-21851113 GCCCTGTAATTAAGGTCATTGGG + Intronic
1052188376 9:25626779-25626801 GCCCTGTGATTAAGGTAAATGGG + Intergenic
1052227829 9:26110200-26110222 GCCCTGTGATTACGGTCAATGGG + Intronic
1052254266 9:26435580-26435602 GGCATGTGATTAAGATCATAAGG + Intergenic
1052368901 9:27642659-27642681 GCCCTGTGATTCAGGTCAATGGG + Intergenic
1052561328 9:30088178-30088200 CCCCTGTGCTTAAGGTCAATGGG - Intergenic
1052737085 9:32353755-32353777 GCCCTGTGATTAAGGTCATTGGG - Intergenic
1053695715 9:40637689-40637711 GCACTCTGATTAAGGTAAATGGG - Intergenic
1054306962 9:63436907-63436929 GCACTCTGATTAAGGTAAATGGG - Intergenic
1054405693 9:64760895-64760917 GCACTCTGATTAAGGTAAATGGG - Intergenic
1054439320 9:65246382-65246404 GCACTCTGATTAAGGTAAATGGG - Intergenic
1054491087 9:65775557-65775579 GCACTCTGATTAAGGTAAATGGG + Intergenic
1055205400 9:73723363-73723385 GCCCTGTGAATAAGATCAGTAGG + Intergenic
1055903691 9:81269370-81269392 GCCCTGTGATTGAGGTCAATGGG - Intergenic
1056156927 9:83847025-83847047 GCTCTGTGATTAAGGTCAACTGG + Intronic
1056313992 9:85371114-85371136 GACCTGTGATTAAGGTTAATGGG - Intergenic
1056353613 9:85776501-85776523 GCTCTGTGATTAAGGTCAATTGG - Intergenic
1057100352 9:92353439-92353461 GCCCTGTAAGTAAGGTTAATGGG - Intronic
1057579156 9:96270623-96270645 GCCCTTGGATTAAAATCACTTGG - Intronic
1057646835 9:96884349-96884371 GCCCTGTCATGAAGGTCCATTGG + Intergenic
1058124819 9:101179186-101179208 GCCTTGTGATTAAGGTCAATGGG + Intronic
1058259023 9:102807889-102807911 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1058543927 9:106040924-106040946 GCCCTGTGATTAAGGTCAGTGGG - Intergenic
1060048067 9:120356631-120356653 GCTATGTGATTATGATCAATTGG - Intergenic
1062135774 9:134927137-134927159 CCTCTGTGATTAAGGTCAATGGG + Intergenic
1062135779 9:134927167-134927189 GCCCTGTAATTAAGGTCAATGGG + Intergenic
1202778160 9_KI270717v1_random:11301-11323 GCACTCTGATTAAGGTAAATGGG - Intergenic
1186279761 X:7978936-7978958 GCCCTCTGATTAAGGTCAATGGG + Intergenic
1186469505 X:9810316-9810338 GCCCTGTGATTAAGGTCAAGGGG - Intronic
1186511620 X:10134130-10134152 GCTCTGTGTTCAAGATCAAGGGG - Intronic
1190155242 X:47986052-47986074 GCCCTGTGATTAAAGTCAATGGG + Intronic
1190625131 X:52330063-52330085 GCCTTGTGATTAAGATCAATGGG - Intergenic
1190996509 X:55615666-55615688 GCCCCATGATTAAGGTCAATGGG - Intergenic
1191095479 X:56669379-56669401 GCCCTGTGATTAAAGTCAATGGG - Intergenic
1191133817 X:57042720-57042742 GCCCTGTGACTAAGGTCAATGGG - Intergenic
1191629778 X:63310771-63310793 TCCGTGTGACTAAGGTCAATGGG - Intergenic
1191769261 X:64738274-64738296 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1191941021 X:66482071-66482093 GCCCTGCGATTAAAGTCAATGGG - Intergenic
1191988125 X:67004042-67004064 GTCCCGTAATTAAGGTCAATGGG - Intergenic
1192297458 X:69866201-69866223 ACCTTGTGATTAAGGTCAATGGG - Intronic
1192661341 X:73045971-73045993 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1192673014 X:73166587-73166609 GCCCTGTGGTTAAGTTCAATGGG - Intergenic
1192891231 X:75393028-75393050 GCCCTGTGATTATGGTCAATGGG - Intronic
1192996423 X:76517405-76517427 GCCCTGTGATCAAGGTCTATGGG + Intergenic
1193053739 X:77127582-77127604 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1193288172 X:79738030-79738052 GCCCTGTGATTAAGGTAAATGGG + Intergenic
1193298007 X:79854471-79854493 ACTCTGTGATTAAGATCAATGGG + Intergenic
1193573472 X:83173363-83173385 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1193833197 X:86311925-86311947 GCCCTGTGATTAAGGTCAATGGG + Intronic
1193904705 X:87227642-87227664 GCCCAGTGATTAAGGTCAATGGG + Intergenic
1193914573 X:87350144-87350166 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1193979129 X:88159236-88159258 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194082071 X:89481057-89481079 GCCTCCTGATTAAGTTCAATGGG + Intergenic
1194140606 X:90204364-90204386 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1194163710 X:90487863-90487885 GCCCTGTGATTAACGTCAATAGG - Intergenic
1194174872 X:90632648-90632670 GCCCTATGGTTAAGCTCAATGGG + Intergenic
1194210530 X:91064165-91064187 GCCCTGTGATTCAGGTCAATGGG + Intergenic
1194233095 X:91348102-91348124 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194277182 X:91900048-91900070 GCCCTGTGATTAAGGTCAATTGG - Intronic
1194343548 X:92732903-92732925 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194443767 X:93962908-93962930 GCCCTGTGATTAAGATCAATGGG + Intergenic
1194457191 X:94119294-94119316 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194485348 X:94479111-94479133 GCCCTGTGATTAAAGTCAATGGG + Intergenic
1194513184 X:94820447-94820469 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1194584360 X:95714880-95714902 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194604135 X:95960038-95960060 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1194834184 X:98660619-98660641 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1195748662 X:108143426-108143448 GCCCTGTGATTAAGGTCAATGGG - Intronic
1195782096 X:108478064-108478086 TCTCTGTGATTAAGGTCAATGGG - Intronic
1195809546 X:108815026-108815048 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1196275873 X:113764502-113764524 GCCCTATGATTAAGGTCAATGGG + Intergenic
1196372430 X:114994763-114994785 GCCCTGTGATTAAAGTCAATGGG - Intergenic
1196585539 X:117423138-117423160 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1197002535 X:121454733-121454755 GCCCTGTGATTAAGCTCAATGGG + Intergenic
1197044651 X:121980125-121980147 GCCATGTGATTAAGGTCAATGGG + Intergenic
1197062616 X:122199421-122199443 GCCCTGTGGTTAAGATCAATGGG - Intergenic
1197074195 X:122336054-122336076 GACCTGTGATTAAGGTCAATGGG - Intergenic
1197084003 X:122451874-122451896 GCCCTGTGATTCAGGTCAATGGG - Intergenic
1197182354 X:123549597-123549619 GCCATGTGATTAAGGTCAATGGG + Intergenic
1197244802 X:124157165-124157187 GCCCTGTGATTAAGGTCAATGGG - Intronic
1197386539 X:125810413-125810435 GCTCTGTGATTAAGGTCAGTGGG - Intergenic
1197405407 X:126042017-126042039 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1197409094 X:126094640-126094662 GCCTTGTGATTAAGGTCAATGGG - Intergenic
1197420127 X:126228155-126228177 GACCTGTGATTAAGGTCACTGGG + Intergenic
1197477139 X:126939743-126939765 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1197592119 X:128421208-128421230 GCTCTGTGATTAAGGTCAATGGG + Intergenic
1198307162 X:135394581-135394603 GCCCTGTGATTAAGGCCAATGGG + Intergenic
1198412249 X:136382622-136382644 GCCCTGTGATTAAGGTCAATGGG - Intronic
1198701548 X:139402107-139402129 CCTCTGTGATTAAGGTCAATGGG + Intergenic
1198934283 X:141889670-141889692 GCCCTGTGATTAAGGTCAATGGG + Intronic
1199144217 X:144347148-144347170 GCCCTGTGATTAAGGTTAGTGGG - Intergenic
1199581114 X:149361339-149361361 ACCCTGCGATTAAGGTTAATGGG + Intergenic
1200289544 X:154858559-154858581 GCCCTATGATTCTGGTCAATGGG + Intronic
1200434743 Y:3137247-3137269 GCCTCCTGATTAAGTTCAATGGG + Intergenic
1200486371 Y:3773484-3773506 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1200509972 Y:4065683-4065705 GCCCTGTGAGTAAGGTCAATAGG - Intergenic
1200521521 Y:4213838-4213860 GCTCTATGGTTAAGCTCAATGGG + Intergenic
1200594526 Y:5122147-5122169 GCCCTGTGATTAAGGTCAATTGG - Intronic
1200651903 Y:5849568-5849590 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1200972921 Y:9175890-9175912 GACCTGCGATTAAGGTCAATAGG - Intergenic
1201193483 Y:11469605-11469627 GCACTCTGATTAAGGTAAATGGG - Intergenic
1201400087 Y:13595654-13595676 GCCCTGTGGTTAAAGTCAATGGG - Intergenic
1201529425 Y:14976086-14976108 GCCCTGTGAATAAGATCAATGGG - Intergenic
1202138151 Y:21688618-21688640 GACCTGTGATTAAGGTCAATAGG + Intergenic