ID: 925773442 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:7307394-7307416 |
| Sequence | CTGAGAAATTGGAAGGTGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925773442_925773450 | 18 | Left | 925773442 | 2:7307394-7307416 | CCAGTCACCTTCCAATTTCTCAG | No data | ||
| Right | 925773450 | 2:7307435-7307457 | AATTACACTGTCAGCTTCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925773442 | Original CRISPR | CTGAGAAATTGGAAGGTGAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||