ID: 925773442

View in Genome Browser
Species Human (GRCh38)
Location 2:7307394-7307416
Sequence CTGAGAAATTGGAAGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925773442_925773450 18 Left 925773442 2:7307394-7307416 CCAGTCACCTTCCAATTTCTCAG No data
Right 925773450 2:7307435-7307457 AATTACACTGTCAGCTTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925773442 Original CRISPR CTGAGAAATTGGAAGGTGAC TGG (reversed) Intergenic
No off target data available for this crispr