ID: 925776828

View in Genome Browser
Species Human (GRCh38)
Location 2:7344023-7344045
Sequence GCATGTATTTGATGCCTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925776828_925776834 14 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776834 2:7344060-7344082 TGGGATGAGGCATGGTCTTTGGG No data
925776828_925776829 -6 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776829 2:7344040-7344062 ACATGCGCTATCATAGTCTCTGG No data
925776828_925776835 20 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG No data
925776828_925776833 13 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776833 2:7344059-7344081 CTGGGATGAGGCATGGTCTTTGG No data
925776828_925776831 1 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776831 2:7344047-7344069 CTATCATAGTCTCTGGGATGAGG No data
925776828_925776830 -5 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776830 2:7344041-7344063 CATGCGCTATCATAGTCTCTGGG No data
925776828_925776832 6 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776832 2:7344052-7344074 ATAGTCTCTGGGATGAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925776828 Original CRISPR GCATGTATTTGATGCCTCCA CGG (reversed) Intergenic
No off target data available for this crispr