ID: 925776835

View in Genome Browser
Species Human (GRCh38)
Location 2:7344066-7344088
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925776828_925776835 20 Left 925776828 2:7344023-7344045 CCGTGGAGGCATCAAATACATGC No data
Right 925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr