ID: 925778338

View in Genome Browser
Species Human (GRCh38)
Location 2:7356657-7356679
Sequence CTTAGGTAAGCCCTGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925778338_925778343 5 Left 925778338 2:7356657-7356679 CCTGAACACAGGGCTTACCTAAG No data
Right 925778343 2:7356685-7356707 CGGAGGCAGGTCAAGAACACAGG No data
925778338_925778341 -8 Left 925778338 2:7356657-7356679 CCTGAACACAGGGCTTACCTAAG No data
Right 925778341 2:7356672-7356694 TACCTAAGAGTGACGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925778338 Original CRISPR CTTAGGTAAGCCCTGTGTTC AGG (reversed) Intergenic
No off target data available for this crispr