ID: 925780474

View in Genome Browser
Species Human (GRCh38)
Location 2:7377239-7377261
Sequence GACTCAGGCCCTGCCCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925780467_925780474 4 Left 925780467 2:7377212-7377234 CCACCACCTTGGCCTTGAGATTC No data
Right 925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG No data
925780472_925780474 -8 Left 925780472 2:7377224-7377246 CCTTGAGATTCGTGGGACTCAGG No data
Right 925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG No data
925780468_925780474 1 Left 925780468 2:7377215-7377237 CCACCTTGGCCTTGAGATTCGTG No data
Right 925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG No data
925780471_925780474 -2 Left 925780471 2:7377218-7377240 CCTTGGCCTTGAGATTCGTGGGA No data
Right 925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG No data
925780465_925780474 20 Left 925780465 2:7377196-7377218 CCAACAACTGATCACTCCACCAC No data
Right 925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG No data
925780464_925780474 24 Left 925780464 2:7377192-7377214 CCTACCAACAACTGATCACTCCA No data
Right 925780474 2:7377239-7377261 GACTCAGGCCCTGCCCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925780474 Original CRISPR GACTCAGGCCCTGCCCTTAG AGG Intergenic
No off target data available for this crispr