ID: 925780940

View in Genome Browser
Species Human (GRCh38)
Location 2:7381199-7381221
Sequence CAGAAGTAAGAGAGGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925780936_925780940 -8 Left 925780936 2:7381184-7381206 CCTTGAGGTTCATGTCAGAAGTA No data
Right 925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG No data
925780934_925780940 -1 Left 925780934 2:7381177-7381199 CCGCCAACCTTGAGGTTCATGTC No data
Right 925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG No data
925780931_925780940 2 Left 925780931 2:7381174-7381196 CCCCCGCCAACCTTGAGGTTCAT No data
Right 925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG No data
925780933_925780940 0 Left 925780933 2:7381176-7381198 CCCGCCAACCTTGAGGTTCATGT No data
Right 925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG No data
925780935_925780940 -4 Left 925780935 2:7381180-7381202 CCAACCTTGAGGTTCATGTCAGA No data
Right 925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG No data
925780930_925780940 3 Left 925780930 2:7381173-7381195 CCCCCCGCCAACCTTGAGGTTCA No data
Right 925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG No data
925780932_925780940 1 Left 925780932 2:7381175-7381197 CCCCGCCAACCTTGAGGTTCATG No data
Right 925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925780940 Original CRISPR CAGAAGTAAGAGAGGTCTTG GGG Intergenic
No off target data available for this crispr