ID: 925781901

View in Genome Browser
Species Human (GRCh38)
Location 2:7389102-7389124
Sequence ACTCCAGGTCTCTCACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925781897_925781901 22 Left 925781897 2:7389057-7389079 CCAGCAGGGCAGTCAAATTTTAA 0: 102
1: 604
2: 830
3: 860
4: 781
Right 925781901 2:7389102-7389124 ACTCCAGGTCTCTCACATCCAGG No data
925781896_925781901 29 Left 925781896 2:7389050-7389072 CCGAAATCCAGCAGGGCAGTCAA 0: 294
1: 483
2: 751
3: 891
4: 1011
Right 925781901 2:7389102-7389124 ACTCCAGGTCTCTCACATCCAGG No data
925781898_925781901 -5 Left 925781898 2:7389084-7389106 CCAAAATGATCTCCTTTGACTCC 0: 1250
1: 1855
2: 1529
3: 901
4: 676
Right 925781901 2:7389102-7389124 ACTCCAGGTCTCTCACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925781901 Original CRISPR ACTCCAGGTCTCTCACATCC AGG Intergenic
No off target data available for this crispr