ID: 925786056

View in Genome Browser
Species Human (GRCh38)
Location 2:7432056-7432078
Sequence TGCATTAATCTCATCGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925786051_925786056 -1 Left 925786051 2:7432034-7432056 CCAGGTGCTAAAACCTGTCACAT No data
Right 925786056 2:7432056-7432078 TGCATTAATCTCATCGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925786056 Original CRISPR TGCATTAATCTCATCGGGGT TGG Intergenic
No off target data available for this crispr