ID: 925791630

View in Genome Browser
Species Human (GRCh38)
Location 2:7494396-7494418
Sequence TTGTAGAAGAATATGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925791626_925791630 12 Left 925791626 2:7494361-7494383 CCATCTATTAATGAATGAAGTCA No data
Right 925791630 2:7494396-7494418 TTGTAGAAGAATATGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925791630 Original CRISPR TTGTAGAAGAATATGGGAGA AGG Intergenic
No off target data available for this crispr