ID: 925793718

View in Genome Browser
Species Human (GRCh38)
Location 2:7520438-7520460
Sequence AAACCCGTAATTCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925793718_925793723 20 Left 925793718 2:7520438-7520460 CCTTTCCCAGGAATTACGGGTTT No data
Right 925793723 2:7520481-7520503 GCTTGCTAATGTGTTGGAGAGGG No data
925793718_925793721 14 Left 925793718 2:7520438-7520460 CCTTTCCCAGGAATTACGGGTTT No data
Right 925793721 2:7520475-7520497 CATAATGCTTGCTAATGTGTTGG No data
925793718_925793722 19 Left 925793718 2:7520438-7520460 CCTTTCCCAGGAATTACGGGTTT No data
Right 925793722 2:7520480-7520502 TGCTTGCTAATGTGTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925793718 Original CRISPR AAACCCGTAATTCCTGGGAA AGG (reversed) Intergenic
No off target data available for this crispr