ID: 925794408

View in Genome Browser
Species Human (GRCh38)
Location 2:7526892-7526914
Sequence AGGACTCCTGCCTCTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925794395_925794408 29 Left 925794395 2:7526840-7526862 CCAATGTAGGCAACCAGTCACAG No data
Right 925794408 2:7526892-7526914 AGGACTCCTGCCTCTTCCCAGGG No data
925794399_925794408 16 Left 925794399 2:7526853-7526875 CCAGTCACAGGGTAAGGAGAAGG No data
Right 925794408 2:7526892-7526914 AGGACTCCTGCCTCTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925794408 Original CRISPR AGGACTCCTGCCTCTTCCCA GGG Intergenic
No off target data available for this crispr