ID: 925795499

View in Genome Browser
Species Human (GRCh38)
Location 2:7537845-7537867
Sequence CCACATAAACTTAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925795499_925795508 29 Left 925795499 2:7537845-7537867 CCCTTTACCTTAAGTTTATGTGG No data
Right 925795508 2:7537897-7537919 GACAACAGAAACTTGGTTGGTGG No data
925795499_925795505 22 Left 925795499 2:7537845-7537867 CCCTTTACCTTAAGTTTATGTGG No data
Right 925795505 2:7537890-7537912 TCCTGAGGACAACAGAAACTTGG No data
925795499_925795504 7 Left 925795499 2:7537845-7537867 CCCTTTACCTTAAGTTTATGTGG No data
Right 925795504 2:7537875-7537897 TGTGTTATATGAGTCTCCTGAGG No data
925795499_925795507 26 Left 925795499 2:7537845-7537867 CCCTTTACCTTAAGTTTATGTGG No data
Right 925795507 2:7537894-7537916 GAGGACAACAGAAACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925795499 Original CRISPR CCACATAAACTTAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr