ID: 925799760

View in Genome Browser
Species Human (GRCh38)
Location 2:7586630-7586652
Sequence CCAGAAGACCAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925799760_925799767 30 Left 925799760 2:7586630-7586652 CCTTCTCCCCTCTGGTCTTCTGG No data
Right 925799767 2:7586683-7586705 TTTCCTCAGGCCAAGATATCTGG No data
925799760_925799765 17 Left 925799760 2:7586630-7586652 CCTTCTCCCCTCTGGTCTTCTGG No data
Right 925799765 2:7586670-7586692 TTCCATGCATTAGTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925799760 Original CRISPR CCAGAAGACCAGAGGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr