ID: 925801869

View in Genome Browser
Species Human (GRCh38)
Location 2:7609654-7609676
Sequence GAGGGGAACCACTCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925801869_925801872 -10 Left 925801869 2:7609654-7609676 CCCACCTCAGAGTGGTTCCCCTC No data
Right 925801872 2:7609667-7609689 GGTTCCCCTCTTGCTCATCCTGG No data
925801869_925801876 2 Left 925801869 2:7609654-7609676 CCCACCTCAGAGTGGTTCCCCTC No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data
925801869_925801878 10 Left 925801869 2:7609654-7609676 CCCACCTCAGAGTGGTTCCCCTC No data
Right 925801878 2:7609687-7609709 TGGCCCAAAGACAGGAGAGAAGG No data
925801869_925801880 13 Left 925801869 2:7609654-7609676 CCCACCTCAGAGTGGTTCCCCTC No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925801869 Original CRISPR GAGGGGAACCACTCTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr