ID: 925801872

View in Genome Browser
Species Human (GRCh38)
Location 2:7609667-7609689
Sequence GGTTCCCCTCTTGCTCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925801868_925801872 -9 Left 925801868 2:7609653-7609675 CCCCACCTCAGAGTGGTTCCCCT No data
Right 925801872 2:7609667-7609689 GGTTCCCCTCTTGCTCATCCTGG No data
925801867_925801872 -8 Left 925801867 2:7609652-7609674 CCCCCACCTCAGAGTGGTTCCCC No data
Right 925801872 2:7609667-7609689 GGTTCCCCTCTTGCTCATCCTGG No data
925801865_925801872 11 Left 925801865 2:7609633-7609655 CCTGGGTTGTGCGCTCTCTCCCC No data
Right 925801872 2:7609667-7609689 GGTTCCCCTCTTGCTCATCCTGG No data
925801863_925801872 25 Left 925801863 2:7609619-7609641 CCAGGAGCACTGACCCTGGGTTG No data
Right 925801872 2:7609667-7609689 GGTTCCCCTCTTGCTCATCCTGG No data
925801869_925801872 -10 Left 925801869 2:7609654-7609676 CCCACCTCAGAGTGGTTCCCCTC No data
Right 925801872 2:7609667-7609689 GGTTCCCCTCTTGCTCATCCTGG No data
925801864_925801872 12 Left 925801864 2:7609632-7609654 CCCTGGGTTGTGCGCTCTCTCCC No data
Right 925801872 2:7609667-7609689 GGTTCCCCTCTTGCTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925801872 Original CRISPR GGTTCCCCTCTTGCTCATCC TGG Intergenic
No off target data available for this crispr