ID: 925801876

View in Genome Browser
Species Human (GRCh38)
Location 2:7609679-7609701
Sequence GCTCATCCTGGCCCAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925801871_925801876 -2 Left 925801871 2:7609658-7609680 CCTCAGAGTGGTTCCCCTCTTGC No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data
925801867_925801876 4 Left 925801867 2:7609652-7609674 CCCCCACCTCAGAGTGGTTCCCC No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data
925801865_925801876 23 Left 925801865 2:7609633-7609655 CCTGGGTTGTGCGCTCTCTCCCC No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data
925801868_925801876 3 Left 925801868 2:7609653-7609675 CCCCACCTCAGAGTGGTTCCCCT No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data
925801869_925801876 2 Left 925801869 2:7609654-7609676 CCCACCTCAGAGTGGTTCCCCTC No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data
925801864_925801876 24 Left 925801864 2:7609632-7609654 CCCTGGGTTGTGCGCTCTCTCCC No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data
925801870_925801876 1 Left 925801870 2:7609655-7609677 CCACCTCAGAGTGGTTCCCCTCT No data
Right 925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925801876 Original CRISPR GCTCATCCTGGCCCAAAGAC AGG Intergenic
No off target data available for this crispr