ID: 925801880

View in Genome Browser
Species Human (GRCh38)
Location 2:7609690-7609712
Sequence CCCAAAGACAGGAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925801873_925801880 -4 Left 925801873 2:7609671-7609693 CCCCTCTTGCTCATCCTGGCCCA No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data
925801867_925801880 15 Left 925801867 2:7609652-7609674 CCCCCACCTCAGAGTGGTTCCCC No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data
925801871_925801880 9 Left 925801871 2:7609658-7609680 CCTCAGAGTGGTTCCCCTCTTGC No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data
925801868_925801880 14 Left 925801868 2:7609653-7609675 CCCCACCTCAGAGTGGTTCCCCT No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data
925801874_925801880 -5 Left 925801874 2:7609672-7609694 CCCTCTTGCTCATCCTGGCCCAA No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data
925801869_925801880 13 Left 925801869 2:7609654-7609676 CCCACCTCAGAGTGGTTCCCCTC No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data
925801875_925801880 -6 Left 925801875 2:7609673-7609695 CCTCTTGCTCATCCTGGCCCAAA No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data
925801870_925801880 12 Left 925801870 2:7609655-7609677 CCACCTCAGAGTGGTTCCCCTCT No data
Right 925801880 2:7609690-7609712 CCCAAAGACAGGAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925801880 Original CRISPR CCCAAAGACAGGAGAGAAGG AGG Intergenic
No off target data available for this crispr