ID: 925802994

View in Genome Browser
Species Human (GRCh38)
Location 2:7619958-7619980
Sequence TATGACCCATAGCAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925802994_925803002 19 Left 925802994 2:7619958-7619980 CCTTCCAATTGCTATGGGTCATA No data
Right 925803002 2:7620000-7620022 TGTTGTTGTTGTGGTTTGGTTGG No data
925802994_925803000 10 Left 925802994 2:7619958-7619980 CCTTCCAATTGCTATGGGTCATA No data
Right 925803000 2:7619991-7620013 GAGGTTTTTTGTTGTTGTTGTGG No data
925802994_925802999 -9 Left 925802994 2:7619958-7619980 CCTTCCAATTGCTATGGGTCATA No data
Right 925802999 2:7619972-7619994 TGGGTCATAGAAGACTGGGGAGG No data
925802994_925803001 15 Left 925802994 2:7619958-7619980 CCTTCCAATTGCTATGGGTCATA No data
Right 925803001 2:7619996-7620018 TTTTTGTTGTTGTTGTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925802994 Original CRISPR TATGACCCATAGCAATTGGA AGG (reversed) Intergenic
No off target data available for this crispr