ID: 925807107

View in Genome Browser
Species Human (GRCh38)
Location 2:7661285-7661307
Sequence ACTCCATGTGATGCTCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925807107_925807110 24 Left 925807107 2:7661285-7661307 CCACAATGAGCATCACATGGAGT No data
Right 925807110 2:7661332-7661354 ATCCAGGCCCCAAAATCGCTAGG No data
925807107_925807111 25 Left 925807107 2:7661285-7661307 CCACAATGAGCATCACATGGAGT No data
Right 925807111 2:7661333-7661355 TCCAGGCCCCAAAATCGCTAGGG No data
925807107_925807108 8 Left 925807107 2:7661285-7661307 CCACAATGAGCATCACATGGAGT No data
Right 925807108 2:7661316-7661338 ATGCTGTCTACCAGAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925807107 Original CRISPR ACTCCATGTGATGCTCATTG TGG (reversed) Intergenic
No off target data available for this crispr