ID: 925807495

View in Genome Browser
Species Human (GRCh38)
Location 2:7665289-7665311
Sequence GGTTTAACAACCTCTCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925807495_925807496 -5 Left 925807495 2:7665289-7665311 CCGCTGGGAGAGGTTGTTAAACC No data
Right 925807496 2:7665307-7665329 AAACCTTACCAACACAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925807495 Original CRISPR GGTTTAACAACCTCTCCCAG CGG (reversed) Intergenic
No off target data available for this crispr