ID: 925812948

View in Genome Browser
Species Human (GRCh38)
Location 2:7718962-7718984
Sequence CCTTCCCATCAGAAGCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925812948_925812953 23 Left 925812948 2:7718962-7718984 CCTGTTAGCTTCTGATGGGAAGG No data
Right 925812953 2:7719008-7719030 TCCTCAGAGATGTACTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925812948 Original CRISPR CCTTCCCATCAGAAGCTAAC AGG (reversed) Intergenic
No off target data available for this crispr