ID: 925814319

View in Genome Browser
Species Human (GRCh38)
Location 2:7732787-7732809
Sequence CGCTGGACACCAAAGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925814319_925814323 11 Left 925814319 2:7732787-7732809 CCCCTGAGCTTTGGTGTCCAGCG No data
Right 925814323 2:7732821-7732843 CTCAATCACATGAAGCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925814319 Original CRISPR CGCTGGACACCAAAGCTCAG GGG (reversed) Intergenic
No off target data available for this crispr