ID: 925817609

View in Genome Browser
Species Human (GRCh38)
Location 2:7768843-7768865
Sequence CCAGGGGACCTGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925817609_925817615 -9 Left 925817609 2:7768843-7768865 CCCTGTGCCCTCAGGTCCCCTGG No data
Right 925817615 2:7768857-7768879 GTCCCCTGGGAGCCATACAGTGG No data
925817609_925817620 8 Left 925817609 2:7768843-7768865 CCCTGTGCCCTCAGGTCCCCTGG No data
Right 925817620 2:7768874-7768896 CAGTGGAGCCCCTAGATATGTGG No data
925817609_925817621 9 Left 925817609 2:7768843-7768865 CCCTGTGCCCTCAGGTCCCCTGG No data
Right 925817621 2:7768875-7768897 AGTGGAGCCCCTAGATATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925817609 Original CRISPR CCAGGGGACCTGAGGGCACA GGG (reversed) Intergenic
No off target data available for this crispr