ID: 925818330

View in Genome Browser
Species Human (GRCh38)
Location 2:7775121-7775143
Sequence CCACTGCCACAAAAAGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925818326_925818330 7 Left 925818326 2:7775091-7775113 CCACACTTTTTCTTCCTTCATAG No data
Right 925818330 2:7775121-7775143 CCACTGCCACAAAAAGTACAAGG No data
925818328_925818330 -7 Left 925818328 2:7775105-7775127 CCTTCATAGGAAAATTCCACTGC No data
Right 925818330 2:7775121-7775143 CCACTGCCACAAAAAGTACAAGG No data
925818325_925818330 10 Left 925818325 2:7775088-7775110 CCTCCACACTTTTTCTTCCTTCA No data
Right 925818330 2:7775121-7775143 CCACTGCCACAAAAAGTACAAGG No data
925818324_925818330 21 Left 925818324 2:7775077-7775099 CCAGCTCTTAACCTCCACACTTT No data
Right 925818330 2:7775121-7775143 CCACTGCCACAAAAAGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925818330 Original CRISPR CCACTGCCACAAAAAGTACA AGG Intergenic
No off target data available for this crispr