ID: 925819849

View in Genome Browser
Species Human (GRCh38)
Location 2:7789529-7789551
Sequence GTTGTATTCTCTCCAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925819849_925819852 -1 Left 925819849 2:7789529-7789551 CCTGGCTTTGGAGAGAATACAAC No data
Right 925819852 2:7789551-7789573 CAAAGGAGTAATCCTGCAATGGG No data
925819849_925819851 -2 Left 925819849 2:7789529-7789551 CCTGGCTTTGGAGAGAATACAAC No data
Right 925819851 2:7789550-7789572 ACAAAGGAGTAATCCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925819849 Original CRISPR GTTGTATTCTCTCCAAAGCC AGG (reversed) Intergenic
No off target data available for this crispr