ID: 925824282

View in Genome Browser
Species Human (GRCh38)
Location 2:7832303-7832325
Sequence CTGTGTTACCAGAAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925824277_925824282 17 Left 925824277 2:7832263-7832285 CCAGCACACATACATGCACCTTT No data
Right 925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG No data
925824280_925824282 -1 Left 925824280 2:7832281-7832303 CCTTTTCAAGGACACATACTGGC No data
Right 925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925824282 Original CRISPR CTGTGTTACCAGAAGGAGCA TGG Intergenic
No off target data available for this crispr