ID: 925825988

View in Genome Browser
Species Human (GRCh38)
Location 2:7849084-7849106
Sequence ATTACTATGGAGAAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925825988_925825991 14 Left 925825988 2:7849084-7849106 CCTTCATCCTTCTCCATAGTAAT No data
Right 925825991 2:7849121-7849143 TCCTTTTATGACAGCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925825988 Original CRISPR ATTACTATGGAGAAGGATGA AGG (reversed) Intergenic
No off target data available for this crispr