ID: 925833360

View in Genome Browser
Species Human (GRCh38)
Location 2:7918154-7918176
Sequence AAGAGGACATGGAGAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925833360_925833368 13 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833368 2:7918190-7918212 AACCCTGGTACAGTGTGGGAAGG No data
925833360_925833369 14 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833369 2:7918191-7918213 ACCCTGGTACAGTGTGGGAAGGG No data
925833360_925833373 26 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833373 2:7918203-7918225 TGTGGGAAGGGACAGCACAAGGG No data
925833360_925833365 8 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833365 2:7918185-7918207 AGACCAACCCTGGTACAGTGTGG No data
925833360_925833363 -2 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833363 2:7918175-7918197 TTTGTCCTACAGACCAACCCTGG No data
925833360_925833372 25 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data
925833360_925833366 9 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833366 2:7918186-7918208 GACCAACCCTGGTACAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925833360 Original CRISPR AAGAGGACATGGAGAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr