ID: 925833361

View in Genome Browser
Species Human (GRCh38)
Location 2:7918165-7918187
Sequence TCTGTAGGACAAAGAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925833361_925833365 -3 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833365 2:7918185-7918207 AGACCAACCCTGGTACAGTGTGG No data
925833361_925833366 -2 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833366 2:7918186-7918208 GACCAACCCTGGTACAGTGTGGG No data
925833361_925833375 29 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833375 2:7918217-7918239 GCACAAGGGTATGAATGACTGGG No data
925833361_925833374 28 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833374 2:7918216-7918238 AGCACAAGGGTATGAATGACTGG No data
925833361_925833368 2 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833368 2:7918190-7918212 AACCCTGGTACAGTGTGGGAAGG No data
925833361_925833372 14 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data
925833361_925833373 15 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833373 2:7918203-7918225 TGTGGGAAGGGACAGCACAAGGG No data
925833361_925833369 3 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833369 2:7918191-7918213 ACCCTGGTACAGTGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925833361 Original CRISPR TCTGTAGGACAAAGAGGACA TGG (reversed) Intergenic
No off target data available for this crispr